Ольга глазунова верховье: Технические работы

Содержание

Полевова Светлана Вячеславовна - пользователь, сотрудник

Полевова Светлана Вячеславовна пользователь

МГУ имени М.В. Ломоносова, Биологический факультет, Кафедра высших растений, Лаборатория экологии, биологических инвазий и охраны природы, ведущий научный сотрудник, с 6 июня 2016
кандидат биологических наук с 1999 года
Прежние места работы (Нажмите для отображения)
Соавторы: Северова Е.Э., Волкова О.А., ЗОЛАЛА Х.А., Теклева М.В., Девятов А.Г., Теклёва М.В., Gabaraeva N., Леунова В.М., Соколова О.С., Grigorjeva V., Завьялова Н.Е., Игнатов М.
С., Косенко Я.В. показать полностью..., Щербаков А.В., Siljamo P., Sofiev M., Горбаренко Е.В., Еремина И.Д., Ермаков И.П., Жданова Е.Ю., Локощенко М.А., Матвеева Н.П., Незваль Е.И., Неретина Т.В., Чубарова Н.Е., Bugdaeva E., Zavialova N., Авилова К.В., Антонов С.А., Брейгина М.А., Гребенников П.Б., Игнатова Е.А., Клинов Д.В., Комаров А.Ю., Крамина Т.Е., Куликова Г.Г., Майоров С.Р., Нилова М.В., Платонова А.Г., Романова Е.С., Селиверстов Ю.Г., Сократов С.А., Филин В.Р., Фырнин Д.М., Шиловцева О.А., Шипунов А.Б., Davydova L.I., Krassilov V.A., Markevich V., Ranta Н., Ашихмина Д.А., Билаш Н.Г., Бовина И.Ю., Богданов А.
Г., Богданович А.Ю., Богуш В.Г., Бойко Г.А., Ванина Л.С., Давыдова Л.И., Дебабов В.Г., Докукин Ю.В., Кавтарадзе Д.Н., Казарова С.Ю., Кирпичников М.П., Колесникова М.А., Купцов С.В., Лаврова Т.В., Лотова Л.И., Моисеенко А.В., Рудько А.И., Савин А.П., Смирнова А.В., Станишнева-Коновалова Т.Б., Тихомиров В.Н., Токарев П.И., Федосов В.Э., Шуклина А.С., Blackmore S., Bogush V., Debabov V., Derkacheva N.I., Gabarayeva N.I., Grigorieva V., Grigorjeva V.V., HISCOCK S.J., Hemsley A.R., Kolesnikova M.S., Kukkonen J., Linkosalo T., Mamaeva A., Neuman F.H., Rimskaya-Korsakova N.N., SPIRINA U.N., Scott L., Skjoth C.A., Suetsugu K.
, Sun G., Sun G., Tagane S., Voronkova T.V., Абрамова Л.А., Аверьянов Л.В., Авраменко А.С., Алексеев Ю.Е., Ахиярова К.И., Барицкий Д.С., Барыкина Р.П., Беликов И.Б., Березина Н.А., Блэкмо С., Бугдаева Е.В., Бузунова О.А., Бунина Н.А., Владимирова М.Ю., Вольперт Е.В., Ворошилов А.А., Габараева Н.И., Гаврилова О.А., Глазунова К.П., Головина Е.О., Горденко Н.В., Григорьев В.В., Гузь Г.В., Демидова А.Н., Деркачева Н.И., Дорофеев А.В., Евменьева А.А., Егорова В.Н., Еленевский А.Г., Енукова Е.А., Ершова Е.Г., Жмылев В.П., Захарова Е.А., Иванов О.В., Иванова Е.И., Киселев А.А., Киселева Л.Л., Колесникова, Константинов П.
И., Корнева И.А., Королькова Е.О., Кривцов В.И., Кривцов Н.И., Криницына А.А., Куранова Н.Г., Кучеров И.Б., Лазарева Н.С., Мавродиев Е.В., Максимов Н.М., Маркевич В.С., Мейер-Меликян Н.Р., Мейчик Н.Р., Минин А.А., Мурашев, Николаева Ю.И., Носова А.А., Нуралиев М.С., Октябрёва Н.Б., Орлова О.А., Павлова И.В., Пастухова А.А., Перепелкин В.Г., Полюхов А.А., Пригоряну О.М., Радыгина В.И., Роги Г., Русанович И.И., Сагалаев В.A., Ситникова И.П., Скворцов В.Э., Скороход А.И., Соколов Д.Д., Сокольский С.С., Сосинская И.Н., Спирина У.Н., Сухова Д.В., Сухоруков А.П., Сучилин А.А., Тимонин А.К., Турчанинова А.С., Филина Н.И., Фёдорова Т.
А., Хлестова Ю.О., Цвелев Н.Н., Чепинога В.В., Шанцер И.А., Щелкунов М.И., Юдина С.В., Юрцева О.В.
89 статей, 10 книг, 34 доклада на конференциях, 38 тезисов докладов, 32 НИР, 4 научного отчёта, 3 награды, 2 членства в научных обществах, 2 диссертации, 1 дипломная работа, 3 учебных курса, 12 выступления в СМИ
Количество цитирований статей в журналах по данным Web of Science: 206, Scopus: 208

РИНЦ:
IstinaResearcherID (IRID): 413331
Scopus Author ID: 6505795389
ORCID: 0000-0003-2127-5639

Деятельность


  • Статьи в журналах
      • 2021 Palynological study of Asian Thismia (Thismiaceae: Dioscoreales) reveals an unusual pollen type
      • Severova Elena E. , Polevova Svetlana V., Yudina Sophia V., Truong Ba Vuong, Do Thi Xuyen, Chantanaorrapint Sahut, Suetsugu Kenji, Tagane Shuichiro, Guo Xing, Schelkunov Mikhail I., Nuraliev Maxim S.
      • в журнале Plant Systematics and Evolution, издательство Springer Verlag (Germany), том 307, № 5 DOI
      • 2016 Andreaeobryum macrosporum (Andreaeobryopsida) in Russia, with additional data on its morphology
      • Ignatov M. S., Ignatova E.A., Fedosov V.E., Ivanov O.V., Ivanova E.I., Kolesnikova M.A., Polevova S.V., Spirina U.N., Voronkova T.V.
      • в журнале Arctoa, издательство
        Общество с ограниченной ответственностью Товарищество научных изданий КМК (Москва)
        , том 25, № 1, с. 1-51 DOI
      • 2016 BOTANY-COLLECTION.BIO.MSU.RU: ИНФОРМАЦИОННАЯ СИСТЕМА ПО АНАТОМИИ И МОРФОЛОГИИ РАСТЕНИЙ
      • Северова Е. Э., Нилова М.В., Девятов А.Г., Волкова О.А., Майоров С.Р., Полевова С.В., Платонова А.Г., Рудько А.И., Филин В.Р., Фырнин Д.М.
      • в журнале Вестник Московского университета. Серия 16: Биология, издательство
        Изд-во Моск. ун-та (М.)
        , № 3, с. 17-19
      • 2016 Botany-Collection.Bio.Msu.Ru: Information System on Plant Morphology and Anatomy
      • Severova E. E., Nilova M.V., Devyatov A.G., Volkova O.A., Maiorov S.R., Polevova S.V., Platonova A.G., Rud’ko A.I., Filin V.R., Fyrnin D.M.
      • в журнале Moscow University Biological Sciences Bulletin, издательство Allerton Press (New York, N.Y., United States), том 71, № 3, с. 126-127 DOI
      • 2016 ОТКРЫТАЯ ИНФОРМАЦИОННАЯ СИСТЕМА ПО АНАТОМИИ И МОРФОЛОГИИ РАСТЕНИЙ ДЛЯ ИДЕНТИФИКАЦИИ ОБЪЕКТОВ РАСТИТЕЛЬНОГО ПРОИСХОЖДЕНИЯ
      • Северова Е. Э., Нилова М.В., Девятов А.Г., Волкова О.А., Полевова С.В., Платонова А.Г., Рудько А.И., Филин В.Р., Фырнин Д.М.
      • в журнале Бюллетень Московского общества испытателей природы. Отдел биологический, издательство
        Изд-во Моск. ун-та (М.)
        , том 121, № 4
      • 2014 Палиноморфология диких видов и форм яблони (Malus, Risaceae)
      • Полевова С. В., Косенко Я.В., Леунова В.М., Романова Е.С., Северова Е.Э., Теклева М.В.
      • в журнале Ботанический журнал, издательство Наука (СПб.), том 99, № 12, с. 1317-1335
      • 2012 Ni2+ effects on Nicotiana tabacum L. pollen germination and pollen tube growth
      • Breygina M. , Matveyeva N., Polevova S., Meychik N., Nikolaeva Yu, Mamaeva A., Yermakov I.
      • в журнале BioMetals, издательство Springer Nature (Switzerland), том 25, № 6, с. 1221-1233 DOI
      • 2010 Quarternary structure formation by recombinant analogues of spider silk proteins
      • Sokolova O. S., Bogush V.G., Davydova L.I., Polevova S.V., Antonov S.A., Neretina T.V., Klinov D.V., Debabov V.G., Kirpichnikov M.P.
      • в журнале Molecular Biology, издательство Maik Nauka/Interperiodica Publishing (Russian Federation), том 44, № 1, с. 162-169
      • 2010 Формирование четвертичной структуры рекомбинантными аналогами белков паутины
      • Соколова О.С., Богуш В. Г., Давыдова Л.И., Полевова С.В., Антонов С.А., Неретина Т.В., Клинов Д.В., Дебабов В.Г., Кирпичников М.П.
      • в журнале Молекулярная биология, том 44, № 1, с. 162-169
      • 2008 Sources, impact and exchange of early-spring birch pollen in the Moscow region and Finland
      • Siljamo, P, Sofiev M. , Severova E., Ranta H., Kukkonen J., Polevova S., Kubin e., Minin A.
      • в журнале Aerobiologia, издательство Pergamon Press Ltd. (United Kingdom), том 24, с. 211-230 DOI
      • 2003 Светлой памяти Германа Павловича Гапочки
      • Барыкина Р. П., Кавторадзе Д.Н., Куликова Г.Г., Лотова Л.И., Полевова С.В., Тимонин А.К., Филин В.Р.
      • в журнале Бюллетень Московского общества испытателей природы. Отдел биологический, издательство Изд-во Моск. ун-та (М.), том 108, № 6, с. 76-79
      • 2003 Флористические находки в Топозерском флористическом районе Карелии (Karelia Keretina
      • Абрамова Л.А., Римская-Корсакова Н. Н., Сухова Д.В., Полевова С.В., Шипунов А.Б., Кучеров И.В., Чепинога В.В., Головина Е.О.
      • в журнале Бюллетень Московского общества испытателей природы. Отдел биологический, издательство Изд-во Моск. ун-та (М.), том 108, № 3, с. 79-81
  • Статьи в сборниках
      • 2015 Ключ для определения изоспор современных папоротников
      • Полевова С. В., Березина Н.А., Волкова О.А., Демидова А.Н., Ершова Е.Г., Леунова В.М., Павлова И.В., Северова Е.Э., Федосов В.Э.
      • в сборнике Современная микропалеонтология. Сборник трудов XVI Всероссийского микропалеонтологического совещания, место издания АО ИО РАН Калининград, с. 393-397
      • редактор Тесакова Екатерина Михайловна
      • 2007 On influence of long-range transport of pollen grains onto pollinating season
      • Siljamo, P, Sofiev M. , Severova E., Ranta H., Polevova S.
      • в сборнике Air Pollution Modeling and Its Application XVIII, место издания ELSEVIER 525 B STREET, SUITE 1900, SANDIEGO, USA, CA, 92101-4495, том 6, с. 708-716
      • 2007 On influence of long-range transport of pollen grains onto pollinating season
      • Siljamo P., Sofiev M., Severova E., Ranta H. , Polevova S.
      • в сборнике Air Pollution Modeling and Its Application XVIII, место издания ELSEVIER 525 B STREET, SUITE 1900, SANDIEGO, USA, CA, 92101-4495, том 6, с. 708-716
  • Книги
      • 2018 Эколого-климатические характеристики атмосферы Москвы в 2017 г. по данным Метеорологической обсерватории МГУ имени М.В.Ломоносова. Под редакцией М.А. Локощенко
      • Локощенко М. А., Жданова Е.Ю., Богданович А.Ю., Горбаренко Е.В., Перепёлкин В.Г., Енукова Е.А., Незваль Е.И., Чубарова Н.Е., Вольперт Е.В., Еремина И.Д., Северова Е.Э., Волкова О.А., Полевова С.В., Комаров А.Ю., Селиверстов Ю.Г., Сократов С.А., Турчанинова А.С., Гребенников П.Б., Казарова С.Ю., Купцов С.В., Бойко Г.А., Лаврова Т.В., Ванина Л.С., Авилова К. В., Сучилин А.А., Владимирова М.Р.
      • издательство ООО "МАКС Пресс" (Москва) , ISBN 978-5-317-05987-3, 240 с. DOI
      • 2017 Эколого-климатические характеристики атмосферы в 2016 г. по данным метеорологической обсерватории МГУ имени М.В. Ломоносова под редакцией Е.И. Незваль, И.В.Сошинской
      • Жданова Е.Ю., Локощенко М.А., Богданович А.Ю., Горбаренко Е.В., Сошинская И.В., Шиловцева О. А., Незваль Е.И., Чубарова Н.Е., Хлестова Ю.О., Еремина И.Д., Северова Е.Э., Волкова О.А., Полевова С.В., Комаров А.Ю., Селиверстов Ю.Г., Сократов С.А., Гребенников П.Б., Казарова С.Ю., Купцов С.В., Бойко Г.А., Лаврова Т.В., Ванина Л.С., Авилова К.В.
      • место издания МАКС Пресс Москва, ISBN 978-5-317-05711-4, 245 с.
      • 2016 Эколого-климатические характеристики атмосферы в 2015 г. по данным метеорологической обсерватории МГУ имени М.В. Ломоносова
      • Авилова К.В., Бунина Н.А., Волкова О.А., Горбаренко Е.В., Гребенников П.Б., Еремина И.Д., Жданова Е.Ю., Комаров А.Ю., Локощенко М.А., Морозов Н.С., Незваль Е.И., Полевова С.В., Пастухова А.А., Северова Е.Э., Селиверстов Ю.Г., Сократов С.А., Худяков В.В., Чубарова Н.Е., Шиловцева О.А.
      • место издания МАКС Пресс 2016, ISBN 978-5-317-05424-3, 268 с.
      • 2015 Эколого-климатические характеристики атмосферы в 2014 г. по данным Метеорологической обсерватории МГУ имени М.В. Ломоносова. Под ред. Шиловцевой О.А. и Незваль Е.И
      • Ахиярова К.И., Беликов И.Б., Волкова О.А., Горбаренко Е.В., Еремина И.Д., Жданова Е.Ю., Константинов П.И., Корнева И.А., Локощенко М.А., Незваль Е.И., Полевова С.В., Полюхов А.А., Северова Е.Э., Ситникова И.П., Скороход А.И., Чубарова Н.Е., Шиловцева О.А.
      • место издания МАКС Пресс Москва, ISBN 978-5-317-05113-6, 235 с.
      • 2006 Маевский П.Ф. Флора cредней полосы европейской части России. 10-е изд
      • Аверьянов Л.В., Александрова, Алексеев Ю.Е., Бузунова, Виноградова, Ворошилов, Гельтман, Глазунова К.П., Дорофеев, Егорова, Еленевский, Жмылев, Игнатов, Казакова, Киселева, Конечная, Крамина Т.Е., Куранова, Левичев, Луферов, Майоров С.Р., Мавродиев Е.В., Никитин В.В., Новиков В.С., Октябрева, Папченков, Полевова С.В., Русанович И.И., Сагалаев В.А., Северова Е.Э., Сенников А.И., Скворцов А.К., Скворцов В.Э., Соколов Д.Д., Сухоруков А.П., Тихомиров В.Н., Татанов И.В., Федорова Т.А., Цвелев Н.Н., Шанцер И.А., Шипунов А.Б., Щербаков А.В., Юрцева О.В.
      • место издания Товарищество научных изданий КМК Москва, 600 с.
  • Доклады на конференциях
      • 2015 КЛЮЧ ДЛЯ ОПРЕДЕЛЕНИЯ ИЗОСПОР СОВРЕМЕННЫХ ПАПОРОТНИКОВ (Стендовый)
      • Авторы: Федосов В.Э., Полевова С.В., Березина Н.А., Волкова О.А., Демидова А.Н., Ершова Е.Г., Леунова В.М., Павлова И.В., Северова Е.Э.
      • XVI Всероссийское Микропалеонтологическое совещание «Современная микропалеонтология», Калининград, Россия, 24-27 августа 2015
  • Тезисы докладов
      • 2008 The nanofibrils formation by the recombinant analogs of spidroins I and II
      • Sokolova O., Bogush V., Davydova L., Klinov D., Neretina T., Polevova S., Debabov V.
      • в сборнике Joint Conference of the 33rd FEBS Congress/11th IUBMB Conference, JUN 28-JUL 03, 2008, Athens, GREECE, серия FEBS JOURNAL, тезисы
      • 2008 Апертурные типы представителей подсемейства Paronychioideae (Caryophyllaceae)
      • Полевова С.В., Косенко Я.В., Леунова В.М., Романова Е.С., Северова Е.Э., Теклёва М.В., Токарев П.И.
      • в сборнике Палинология: стратиграфия и геоэкология. Сборник научных трудов XII Всероссийской Палинологической конференции (29 сентября – 4 октября 2008 г, Санкт-Петербург), место издания СПб.: ВНИГРИ, том 1, тезисы, с. 98-103
      • 2006 Complex evaluation of allergenic seasons in central and northern Europe using aerobiological and phenological observations and dispersion models
      • Sofiev M., Sijamo P., Ranta H., Linkosalo T., Severova E., Polevova S.
      • в сборнике The 8th International Congress on Aerobiology “Towards a comprehensive vision” Neuchatel, Switzerland 21-25 August 2006, место издания Neuchatel, Switzerland, тезисы, с. 174-174
  • НИРы
      • 1 января 2021 - 31 декабря 2025 Анализ структурного и хорологического разнообразия высших растений в связи с проблемами их филогении и таксономии; проблемы экологии города и устойчивого развития
      • Кафедра высших растений
      • Руководитель: Соколов Д.Д. Участники НИР: Барыкина Р.П., Беэр А.С., Борисюк А.А., Ванина Л.С., Веселова Т.Д., Волкова О.А., Девятов А.Г., Джалилова Х.Х., Ерёмкин Г.С., Зернов А.С., Калиниченко И.М., Карпунина П.В., Копылов-Гуськов Ю.О., Крамина Т.Е., Локк И.Э., Лысков Д.Ф., Майоров С.Р., Мокиевская  Н.В., Нилова М.В., Петрова С.Е., Платонова А.Г., Площинская М.Е., Полевова С.В., Ремизова М.В., Рудько А.И., Северова Е.Э., Сухоруков А.П., Тимонин А.К., Филин В.Р., Фомичев К.И., Фридман В.С., Фёдорова Т.А., Чубатова Н.В., Щербаков А.В., Юрцева О.В.
      • 7 ноября 2019 - 30 сентября 2020 Развитие крупной уникальной научной установки "Трехмерная электронная микроскопия и спектроскопия" МГУ имени М.В.Ломоносова
      • Биологический факультет
      • Руководитель: Кирпичников М.П. Ответственные исполнители: Полевова С.В., Рамонова А.А., Соколова О.С. Участники НИР: Армеев Г.А., Архипова А.Ю., Багров Д.В., Волох О.И., Карлова М.Г., Моисеенко А.В., Новоселецкий В.Н., Рамонова А.А., Соколов Д.Д., Соловченко А.Е., Станишнева-Коновалова Т.Б., Темерева Е.Н., Шайтан К.В.
      • 1 января 2016 - 31 декабря 2020 Анализ структурного и хорологического разнообразия высших растений в связи с проблемами их филогении, таксономии и устойчивого развития
      • Кафедра высших растений
      • Руководитель: Соколов Д.Д. Участники НИР: Ахметьев М.А., Барыкина Р.П., Беэр А.С., Борисюк А.А., Ванина Л.С., Веселова Т.Д., Волкова О.А., Девятов А.Г., Джалилова Х.Х., Ерёмкин Г.С., Зернов А.С., Калиниченко И.М., Карпунина П.В., Константинова А.И., Копылов-Гуськов Ю.О., Крамина Т.Е., Куликова Г.Г., Локк И.Э., Лотова Л.И., Лысков Д.Ф., Майоров С.Р., Мокиевская  Н.В., Нилова М.В., Петрова С.Е., Платонова А.Г., Площинская М.Е., Полевова С.В., Ремизова М.В., Рудько А.И., Северова Е.Э., Сухоруков А.П., Тимонин А.К., Филин В.Р., Фомичев К.И., Фридман В.С., Фёдорова Т.А., Чубатова Н.В., Щербаков А.В., Эль Е.С., Юрцева О.В.
      • 1 января 2015 - 31 декабря 2018 Научные основы создания Национального банка-депозитария живых систем
      • Ректорат
      • Руководитель: Садовничий В.А. Ответственный исполнитель: Каменский П.А. Участники НИР: Cоина В.С., Rimskaya-Korsakova N.N., Абрамов С.М., Аверина О.А., Агеева Л.В., Адельянов А.М., Азовский А.И., Акопян Ж.А., Аксенова А.А., Аксенова В.А., Аксянов Е.А., Аласания К.Ю., Алдобаева И.И., Александров В.В., Александрова А.В., Александрушкина Н.И., Александрушкина Н.А., Алексеевский А.В., Алешин В.В., Аляутдинов А.Р., Алёшин В.В., Андреева Т.В., Антал Т.К., Антоновская А.А., Антохина О.Г., Арифулин Е.А., Армеев Г.А., Артюшин И.В., Арушанян И.О., Ахметжанова А.А., Ашапкин В.В., Бабенко В.А., Бакеева Л.Е., Балацкий А.В., Банникова А.А., Баринова Н.Н., Баулина О.И., Бацевич В.А., Бедарева И.В., Белевич Т.А., Беме И.Р., Бенедиктов А.А., Березина Н.Я., Биланенко Е.Н., Бисерова Н.М., Благовещенская Е.Ю., Боброва В.К., Бондарева Э.А., Бондаренко Г.Н., Борисанова А.О., Брагина Е.Е., Брызгалина Е.В., Бубнова Е.Н., Бугров Д.И., Бушуев А.В., Бызов Б.А., Бычков А.Ю., Бычкова Е.Ю., Вайпан Д.В., Вайс В.Б., Вальехо-Роман К.М., Вангели И.М., Ванюшин Б.Ф., Варлыгина Т.И., Вархотов Т.А., Васильев А.Н., Васильева Е.Д., Васильева С.Г., Вилкул Е.А., Виноградова Е.Н., Виноградская М.И., Владыченская И.П., Водопьянов С.С., Волкова О.А., Волкова О.С., Волцит О.В., Воробьева Е.А., Воронина Е.Ю., Воронко О.В., Ворцепнева Е.В., Высоких М.Ю., Гавриленко С.М., Галинская Т.В., Галкин И.И., Галоян Э.А., Ганчарова О.С., Гаранина А.С., Георгиев А.А., Герасимов Е.С., Глаголева Е.С., Глушакова А.М., Гмошинский В.И., Гоголева С.С., Година Е.З., Головин А.В., Гололобова М.А., Гомыранов И.А., Горелова О.А., Горшкова Е.А., Горюнов Д.В., Гофман Д.К., Григорьев Ф.В., Григорьева А.А., Григорьева О.А., Грицышин В.А., Груздева М.А., Грум-Гржимайло О.А., Гусев Ф.Е., Данилович И.Л., Дегтярева Г.В., Диброва Д.В., Добров Б.В., Добровольская Т.Г., Дроздова О.Ю., Дуброва М.С., Дудов С.В., Дудова К.В., Дыйканов Д.Т., Дьяков М.Ю., Евтеев А.А., Ежова О.В., Екимова И.А., Еланский С.Н., Елумеева Т.Г., Емельянова Л.Г., Еремичев Р.Ю., Ерохина М.В., Ефименко А.Ю., Ефимов С.В., Жадан А.Э., Жирков И.А., Зайцева (Кублановская) А.А., Захаров К.В., Землемерова Е.Д., Зернов А.С., Зубкова Е.Н., Иваненко В.Н., Иваницкая О.Н., Иваницкий В.В., Иванов А.О., Иванова А.Е., Игнатов М.С., Игнатова Е.А., Ильина И.Ю., Ильинская О.П., Калякин М.В., Камалов А.А., Карапетян М.К., Касумян А.О., Каткова Е.В., Качалкин А.В., Квятковский А.Л., Квятковский А.Я., Керимов А.Б., Климович П.С., Климчук О.И., Клёнова А.В., Кнорре Д.А., Князева А.А., Кобельков Г.М., Кобельков С.Г., Кокаева Л.Ю., Колбасов Г.А., Колбасова Г.Д., Колесниченко К.А., Кондакова О.А., Коновалова О.П., Конюхов И.В., Копылов-Гуськов Ю.О., Королев Д.Е., Королева А.Т., Корсуновская О.С., Коршунова Г.А., Коршунова Т.А., Кочкин Д.В., Кошелева Н.В., Крайнов В.Н., Крамина Т.Е., Кремнёв С.В., Криницына А.А., Крупицкий А.В., Крускоп С.В., Кручинин П.А., Кручинина А.П., Кузищин К.В., Кузнецов А.Г., Кулебякин К.Ю., Кулебякина М.А., Куприянова Е.В., Кураков А.В., Кутов Д.К., Кутуева Л.И., Кутузова И.А., Кушунина М.А., Лазарев Е.Н., Лапашина А.С., Лапыгина Е.В., Лебедев В.С., Левик Л.Ю., Лемак С.С., Леонтьева О.А., Лисенкова А.А., Лисовский А.А., Лобакова Е.С., Логачёва М.Д., Лопатина Ю.В., Лубнина Н.В., Лукашевич Н.В., Лукьянов А.А., Лысак Л.В., Лысков Д.Ф., Мазей Ю.А., Макарова Н.Е., Максимова И.А., Малахов В.В., Малютина А.М., Манахов А.Д., Манских В.Н., Манучарова Н.А., Маркина М.М., Маркова О.В., Марова-Кляйнбуб И.М., Мартынов А.В., Марфенина О.Е., Маслакова А.А., Мелихова Е.В., Мельникова М.Н., Милютина И.А., Михайлов К.В., Михайлов К.Г., Морковин А.А., Москаленко В.Н., Мохова Е.Н., Мулкиджанян А.Я., Мунтян М.С., Мурашев В.В., Мурашев И.А., Нагаев Б.Э., Назаров П.А., Назаров Р.А., Нанова О.Г., Недоспасов С.А., Неретин Н.Ю., Неретина Т.В., Нестеренко А.М., Нетрусов А.И., Никитин М.А., Нилова М.В., Нимирицкий П.П., Новаковский Г.Э., Новаковский Г.Э., Новоселецкая Е.С., Новоселецкий В.Н., Носов А.М., Оболенская Е.В., Овченков Е.А., Огурцов С.В., Озеров А.Л., Озрина Р.Д., Олейникова О.В., Олейникова О.В., Онипченко В.Г., Онищенко Г.Е., Орлов Д.С., Орловский И.В., Павлинов И.Я., Павлов Д.С., Павлов С.Д., Павлова Н.С., Панина О.Б., Панютина А.А., Парфёнова Е.В., Пенин А.А., Перехватов В.В., Петракова О.С., Петров Н.Б., Петров П.Н., Петрунина А.С., Петушкова Ю.А., Пивоваров Е.А., Плетюшкина О.Ю., Плеханова О.С., Погосян С.И., Поздняков Л.А., Полевова С.В., Полилов А.А., Поляков М.П., Полянская Л.М., Попеленский Ф.Ю., Попкова Е.Г., Попов В.С., Попова Е.Н., Попова О.В., Попова С.С., Поярков Н.А., Просвиров А.С., Птушенко В.В., Пугачева Т.Т., Рамонова А.А., Распопова А.А., Ревина Д.Б., Редькин Я.А., Решетников Р.В., Рогаев Е.И., Романов А.А., Романова Е.С., Романова Е.С., Рубина К.А., Румянцев В.Ю., Русин Л.Ю., Русинов И.С., Рыжов А.Л., Рысенкова К.Д., Савилова З.Д., Савицкая М.А., Савицкий В.Ю., Савкин И.А., Самигуллин Т.Х., Самойлов К.Ю., Самоходская Л.М., Самсонов Т.Е., Северова Е.Э., Селях И.О., Семенова А.В., Семенова Л.Р., Семенова М.Л., Семин В.Н., Семина Е.В., Сенченков Е.П., Сенчукова А.Л., Серегин А.П., Сидоренко Г.Ю., Симоненко Е.Ю., Симонян Р.А., Синев А.Ю., Скулачев В.П., Скулачев К.В., Слободкина Е.А., Смирнова Е.А., Соловченко А.Е., Соловьева Е.Н., Сорокин М.И., Сото Э., Спасская Н.Н., Сперанская А.С., Спирин С.А., Стамбольский Д.В., Старостина Е.Е., Степанов А.Л., Сулимов А.В., Сулимов В.Б., Сумбатян Н.В., Суханова Е.С., Сухоруков А.П., Сысоева В.Ю., Тарнопольская М.Е., Тащилова А.С., Твердислов В.А., Темерева Е.Н., Терентьева Е.И., Терехова В.А., Тимошенко В.Ю., Титова М.В., Тихонов В.В., Тишечкин Д.Ю., Токарчук А.В., Томкович П.С., Троицкий А.В., Тужилин А.А., Тузов К.А., Федоров А.В., Федоров В.В., Федорова А.В., Федосеева (Бандолина) Е.В., Федосов В.Э., Фенюк Б.А., Фетисова Е.К., Флегонтов П.Н., Фырнин Д.М., Хайлова Л.С., Храмова Ю.В., Цетлин А.Б., Чеканов К.А., Челомбитько М.А., Черепанов Д.А., Чернов И.Ю., Черняк Б.В., Чертополохов В.А., Чертопруд Е.С., Чесунов А.В., Чивкунова О.Б., Чотчаева Ф.Р., Чубатова Н.В., Чудаев Д.А., Чурикова О.А., Шагиева Г.С., Шайтан А.К., Шайтан К.В., Шалаева Д.Н., Шаранова Н.Э., Шаталкин А.И., Шаталова Н.Н., Шафеи Р.А., Шахпаронов В.В., Шведчикова Н.К., Шестаков А.И., Шилов Е.С., Шиловский Г.А., Шнырева А.В., Штратникова В.Ю., Шубина Е.А., Шуленина Н.Э., Щелкунов М.И., Щербаков П.Н., Эльдаров Ч.М., Юрцева О.В., Яворская М.И., Яковенко С.А., Якушев А.В., Якушев А.Г., Яровая Е.Б.
      • 30 июня 2014 - 31 декабря 2018 Комплексное исследование структуры и динамики ключевых актинсвязывающих белковых комплексов
      • Кафедра биоинженерии
      • Руководитель: Соколова О.С. Ответственные исполнители: Полевова С.В., Станишнева-Коновалова Т.Б., Чемерис А.С. Участники НИР: Волох О.И., Глухов Г.С., Дмитриев Г.В., Печникова Е.В., Полевова С.В., Попинако А.В., Станишнева-Коновалова Т.Б., Чемерис А.С., Шаров Г.Г.
      • 29 ноября 2010 - 19 ноября 2012 Разработка методов исследования структуры и функций актинсвязывающих белков, включая кодируемые 18 хромосомой человека
      • Биологический факультет
      • Руководитель: Шайтан К.В. Участники НИР: Багров Д.В., Глухов Г.С., Ефремов Ю.М., Карлова М.Г., Маслакова А.А., Новоселецкий В.Н., Полевова С.В., Соколова О.С., Станишнева-Коновалова Т.Б., Уласова Н.Ю.
      • 1 ноября 2010 - 15 ноября 2012 Разработка методов исследования структуры и функций потенциал-зависимых ионных каналов, включая кодируемые 18 хромосомой человека
      • Кафедра биоинженерии
      • Руководитель: Кирпичников М.П. Участники НИР: Антонов М.Ю., Багров Д.В., Боздаганян М.Е., Браже А.Р., Волох О.И., Глухов Г.С., Ефремов Ю.М., Карлова М.Г., Касимова М.А., Левцова О.В., Малюченко Н.В., Маслакова А.А., Новоселецкий В.Н., Орехов Ф.С., Оршанский И.А., Печникова Е.В., Пищальникова А.В., Полевова С.В., Попинако А.В., Соколова О.С., Станишнева-Коновалова Т.Б., Трифонова Е.С., Шайтан А.К., Шайтан К.В.
      • 1 января 2006 - 31 декабря 2015 Анализ структурного и хорологического разнообразия высших растений в связи с проблемами их филогении, таксономии и устойчивого развития
      • Кафедра высших растений
      • Руководитель: Тимонин А.К. Участники НИР: Барыкина Р.П., Беэр А.С., Борисюк А.А., Ванина Л.С., Веселова Т.Д., Волкова О.А., Девятов А.Г., Джалилова Х.Х., Ерёмкин Г.С., Зернов А.С., Калиниченко И.М., Константинова А.И., Крамина Т.Е., Куликова Г.Г., Локк И.Э., Лотова Л.И., Майоров С.Р., Мокиевская  Н.В., Морозова З.А., Нилова М.В., Нуралиев М.С., Петрова С.Е., Площинская М.Е., Полевова С.В., Ремизова М.В., Рудько А.И., Северова Е.Э., Соколов Д.Д., Сухоруков А.П., Филин В.Р., Фридман В.С., Фёдорова Т.А., Чубатова Н.В., Щербаков А.В., Юрцева О.В.
  • Отчеты
      • 2012 «Создание атласа спор папоротникообразных мировой флоры» (НИР) I этап (01.07.2011 – 30.06.2012)
      • Авторы: Березина Н.А., Багдасарова Т.В., Демидова А.Н., Ершова Е.Г., Носова М.Б., Павлова И.В., Полевова С.В., Северова Е.Э., Федосов В.Э., Ашуркова Л.Д., Петраш З.Н.
      • #1, 223 с.
  • Награды и премии
  • Членство в научных обществах
  • Руководство диссертациями
  • Диссертация
  • Руководство дипломными работами
  • Авторство учебных курсов
  • Преподавание учебных курсов
  • Выступление в СМИ

Страница не найдена

В главном меню ты найдешь все разделы и страницы сайта. Например, обо всех мероприятиях можно узнать в разделе «События», а в «Главном штабе» находится вся официальная информация о Движении «ЮНАРМИЯ».

Для того чтобы зарегистрироваться на сайте или войти в личный кабинет, нажми на иконку с человечком, которую ты найдешь в правом верхнем углу экрана. Хочешь, чтобы на сайте сразу появлялась информация, которая относится к твоему региону? Нажми на иконку геолокации и дай нам знать о своем местоположении. Ты можешь воспользоваться поиском, кликнув на иконку лупы. Напечатай в поисковой строке ключевые слова и увидишь все страницы сайта, на которых они упоминаются.

В календаре событий найдется информация о каждом мероприятии, в котором принимают участие юнармейцы. Узнав о предстоящих событиях, ты сможешь точно спланировать свое время!

В разделе «Обучение» ты найдешь все, что позволит тебе провести время с интересом и пользой. Читай статьи, слушай познавательные подкасты и смотри видео, специально созданные нашими лучшими корреспондентами.

Тренируй внимательность и ловкость, соревнуйся с друзьями в онлайн-играх! В них можно играть прямо на нашем сайте, выбрав для себя самую подходящую. Моя любимая — «Юнармейские танки»!

Для тех, кто хочет блеснуть своими знаниями и смекалкой, мы постоянно готовим новые испытания в разделе «Тесты». Отвечай на вопросы и делись своими результатами с друзьями!

В «Библиотеке» мы собрали книги, которые должен прочитать каждый юнармеец! В наших подборках есть издания на любой вкус и возраст, уверен, что ты найдешь что-то интересное и для себя.

«Доска почета» говорит сама за себя — здесь ты познакомишься с юнармейцами, которые заслужили звание «самых-самых». Заслужить место на доске почета может каждый, в том числе и ты!

На странице «Аллея Памяти» мы рассказываем о тех, кто совершил настоящий подвиг, но кого с нами больше нет... ЮНАРМИЯ помнит о своих героях.

Страница конкурса «Минута славы» — это возможность для каждого юнармейца поделиться своими творческими способностями и талантами. Смотри видео с теми, кто уже участвует в конкурсе. Выбирай и оценивай самых лучших!

Будь в курсе всего, что происходит в ЮНАРМИИ! Все самое важное ты увидишь на главной странице сайта, а нажав кнопку «Все новости», — сможешь найти весь информационный архив.

Поздравляю, теперь ты знаешь, как пользоваться сайтом ЮНАРМИЯ! Если захочешь пройти инструктаж еще раз — просто кликни на мою иконку в правом нижнем углу твоего экрана.

Сургутяне увидят «Большой балет в кино» | Культура

24.10.2019 08:47

#Культура

#Сургут

Автор: Служба информации ОТРК «Югра», фото - moow.life

Читать новости Югра ТВ в

27 октября Большой театр России открывает десятый сезон «Большого балета в кино». Прямую трансляцию балета «Раймонда» будут показывать в кинотеатрах по всей России, в Сургуте это кинотеатр «Мир».

Показы балетов Большого театра в кино стали возможными благодаря проекту TheatreHD. «Раймонда» в редакции известного хореографа России Юрия Григоровича на музыку Александра Глазунова – классический средневековый роман, история о прекрасной деве, хранящей верность своему рыцарю. Страстный любовный треугольник, сражение на мечах, романтические грёзы, влюбленный сарацин, темпераментные экзотические танцы и классические белые адажио – всё это превращает немного наивную «Раймонду» в настоящий балетный хит, где есть лирика, драма и экшн.

В главных партиях трёхактного имперского спектакля – звёзды Большого театра. Титульную роль исполнит прима Большого – Ольга Смирнова. Рыцарем Жаном де Бриеном станет Артемий Беляков, который в начале сезона получил статус премьера, а его соперником в борьбе за сердце прекрасной дамы, страстным сарацином Абдерахманом будет харизматичный Игорь Цвирко.

Помимо «Раймонды», в сезоне 2019/2020 зрители проекта «Большой балет в кино» увидят ещё три спектакля в прямой трансляции - «Жизель» (26 января 2020 г.), «Лебединое озеро» (23 февраля 2020 г.), («Драгоценности» (19 апреля 2020г.), и три спектакля из сезонов прошлых лет: «Корсар» (17 ноября 2019 г.), «Щелкунчик» (с 15 декабря 2019 г.) и «Ромео и Джульетта» (29 марта 2020 г.).

Были и небылицы колодезя Страстной иконы у деревни Костыши

"Святые источники" или "колодези" находящиеся поблизости от подмосковной деревеньки Костыши места известные любителям чистейшей родниковой воды. Один из них, источник Страстной иконы Божией Матери, располагается в лесу к северо-западу от деревни на правом берегу речки Бродок (правого притока речки Дубенки). Легенды и предания настолько плотно опутывают историю появления родника, что не всегда понятно, где правда и где вымысел. Для ясности повествования мы разделили его на несколько частей, первая из которых повествует о времени появления и утраты часовни у родника при деревни Костыши. Затем впервые публикуется фотография часовни у родника 1913 г, и, также недавно выявленное описание родника 1900 года. В заключительной части, проиллюстрированной недавно выявленной в архиве ИКМ "Усадьба Фряново" наиболее ранней по времени (рубеж XIX и ХХ вв.) фотографией с изображением крёстного хода с иконой Страстной иконы Божией матери, будет приведен полный корпус преданий, связанных с появлением родника и вышеупомянутого "чудотворного" образа. ЧАСОВНЯ У РОДНИКА и УТРАЧЕННЫЙ НИКОЛЬСКИЙ ХРАМ
По данным церковного историка и священника Николая Алексеевича Скворцова (1861 – 1917) из изданной в 1901 году книги "Уничтоженные в Богородском уезде церкви", возникновение часовни связано с упразднением храма Николая Чудотворца в селе Никольском, Костыши тож. Никольский храм упоминался в писцовой книге 1584–1586 гг. и был утрачен до 1621 или 1623 г., затем вновь выстроен до 1646 г., упоминаясь в 1678, 1680, 1682, 1685, 1704, 1712 и 1718 годах. С 1694 по 1719 г. за ветхостью службы в церкви не проводились. Новый деревянный Никольский храм был построен и освящен в 1720 г., упоминался в 1722 и 1739 гг. В 1783 году церковь была упразднена "за крайней ветхостью и нестроением вновь каменной". Всё это время храм числился при частновладельческом (вотчинном) "селе, что был погост в Желтухине, а Лихарево тож на речке на Дубенке" – впоследствии утраченном поселении "усадебного типа". Деревня же Костышевка (нынешняя д. Костыши), располагаясь к юго-востоку от села, "тянула к нему", входя в его землевладение [1; о разделении села Никольского можно узнать из нашей прошлой публикации]. О постройке часовни Н. А. Скворцов говорит следующее: «Из остатков храма по благословению преосвященного Августина, построена на месте церкви часовня усердием жены статского советника Елизаветы Семеновой Смольянской; украшена же и освящена часовня супругом ее Гавриилом Петровичем Смолянским 1821 года 9 октября»[2]. Известно, что Е. С. Смолянская владела д. Костыши в 1812 году [3]. Упоминание преосвященного Августина, архиепископа Московского и Коломенского (февраль/март 1818 – март 1819), говорит о том, что часовня была поставлена в 1818 г., но освящена в 1821 году (ср. с данными temples).

 

Существует недопонимание, где именно находился старинный храм и первоначальная часовня. По собранным в 2002–2004 гг. данным О. Н. Глазуновой, согласно воспоминаниям старожилов, часовня находилась «напротив Никольского "колодца" в кольце лип на месте старинного кладбища» (Глазунова О. Н., с. 18). Священник фряновского храма Алексей (Рукавицын) также, упоминая о "кольце лип", полагает, что изначально храм и часовня располагались в ином месте, поблизости от Никольского же оврага (название оврага, "впадающего" в  р. Дубенку). С этими данными трудно не согласиться, поскольку сложно представить существование первоначального старинного храма в низине у речки Бродок, то есть существе ниже уровня деревни. Тем более, на межевых планах II пол. XVIII в. "половина села Никольского" с храмом находится по обеим берегам оврага – пересохшего правого притока р. Бродок, ныне носящего название "Никольский" [4], тогда как сам родник располагается к северо-востоку от местоположения былого храма, в низине на правом берегу реки Бродок [см.; 5]. Исторические указания храма "на речке на Дубенке" в данном случае не должны нас смущать. Храм имел уточнение своего местоположения по наиболее крупной близлежащей реке, а не по её притокам, малоизвестным и в веке двадцатом...
 

Местность половины села Никольского (села с церковью; левее) и с. Никольского (Костыши; правее) Шеренского стана (c 1781 г. – Богородского уезда) на ПГМ II пол. XVIII в.

Отметим, что во II половине XVIII столетия овраг "Никольский"  носил иное, даже, можно сказать, иные названия. Верховье оврага на одном варианте ПГМ указывалось как "ов<раг> Демковской", а его часть ближе к устью – как "ов<раг> Чебуринской". Верховье оврага, предположительно, носило название по Демкову/Демкинскому болоту, упоминавшемуся в 1490–1495 и 1512 годах [6], которое, в свою очередь могло получить название по деревне Демково Корзенева стана, упоминавшейся в 1512 году [7]. Болото могло служить источником пересохшего правого притока р. Бродок. Низовье оврага носило название по пустоши (1573/74 г.) и деревне Чебурино Воря и Корзенева стана, находившейся на левом берегу оврага и упоминавшейся в писцовых книгах 1585/86 г. [8]. Возможно, уже в составе "пол села Никольского" она указывалось на планах II пол. XVIII в. на левом берегу Чебуринского / Никольского оврага севернее храма и запустела вместе с ним в I пол. XIX столетия. Память о запустении собственно села Никольского после утраты храма жива. Ещё в 2002–2004 гг. старожилы Костышей рассказывали  О. Н. Глазуновой, что "когда-то Костыши стояли в другом месте, за "колодцем". В 1771 г. во время чумы вымерло всё сельцо..." Но к этим преданиям мы вернёмся в заключительной части... Действительно, если сравнить планы XVIII в. с картой Ф. Ф. Шуберта сер. XIX в. мы увидим лишь вторую половину села Никольского под названием "Костыши (Никольское)", располагавшуюся ближе к с. Богородскому (Мосальскому).

"Двойное" село Никольское на "Геометрической карте Московской губернии" 1797 года. Костыши (Никольское) на карте Ф. Ф. Шуберта. Сер. XIX в.

В 1901 году, Н. А. Скворцов в своей книге описывая две примечательные святыни, хранившиеся в часовне, отмечал: «Между другими, находящимися в часовне, иконами есть древняя Страстная икона Божией Матери, вырезанная из дерева и вставленная в позолоченный киот; есть еще чтимая икона великомученицы Параскевы-Пятницы», «в часовне, которая построена на месте храма*, сохранился деревянный крест с надписью: "освятися жертвенник Господа Бога и Спаса нашего Иисуса Христа во храме иже во святых отца нашего Николая архиепископа Мирликийского чудотворца, что в погосте Николаевском Желтухине при державе Благочестивейшего Великого Государя Петра Алексеевича всея великия и малыя и белыя России Самодержца по благословению преосвященного Игнатия Митрополита Сарского и Подонского меж Патриаршества в лето от мироздания 7228, от Рождества Христова 1720 года мая в 24-й день на память преподобного отца нашего Симеона иже на дивной горе» [9]. В отличие от Страстной иконы, никаких данных об упоминаемом кресте не обнаружено. Какова была судьба этой ценнейшей реликвии после закрытия часовни? Память об этом мы, кажется, утратили навсегда...

 

Ответы на вопросы в какие годы Н. А. Скворцов собирал данные о часовне в Костышах, и  документы каких лет служили ему источниками, позволили бы избежать многих затруднений. Книга Н. А. Скворцова была издана в 1901 году, а на публикуемой ниже фотографии 1913 года мы видим часовню, стоящую у берега речки, на месте ныне существующего родника и часовенки, поставленной вместо старого часовенного столпа 2006 году. О каком-либо перенесении самой часовни с места, условно, "кольца лип" / "напротив колодца" / "за колодцем", на то место, на котором она отражена на фотографии 1913 года сведений совершенно не имеется. И это "громкое молчание" о будто бы имевшемся "переносе" часовни с места былого храма на нынешнее место тем более удивительно при учёте обилия местных преданий связанных со святыней, хранившившиейся в часовне – резной Страстной иконой.

*Н. А. Скворцов и бр. Холмогоровы создавали свои книги по епархиальным отчётам, не посещая лично описываемые местности. Неточность в отчёте, и привычная практика постройки памятных часовен на месте алтарей упраздненных храмов, совокупно, могли дать неверное представление о реальном местоположении часовни уже в конце XIX в.

 


 
Святой Никольский "колодец" в Костышах. Фотография ок. 2002 г. из статьи О. Н. Глазуновой. Колодезь и часовенный столп в Костышах. Фотография Ю. В. Воронова, 25 июня 2001 г. sobory.ru

 

По сообщению Риммы Георгиевны Приклоновой (1929 г.р.) из д. Костыши, приведённому в статье О. Н. Глазуновой,  «...часовня была небольшая, и во время службы люди стояли в основном снаружи. Службы в часовне проходили и после революции. Прекратились они примерно в 1932 году, когда часовня стала ветшать и разрушаться. Тогда икону передали в мавринскую церковь. Передавали трижды, утром она оказывалась на прежнем месте. "Потом вся деревня собралась, отслужили молебен, и икона уже осталась в церкви"» [10]. На наш взгляд, описание относится к часовне, стоявшей у родника на правом берегу речки Бродок, а 1932 год может быть принят как время утраты этой деревянной часовенки. 

 

ПЕРВАЯ ВЫЯВЛЕННАЯ ДОРЕВОЛЮЦИОННАЯ ФОТОГРАФИЯ ЧАСОВНИ 1913 гг.

В семьях потомков бывших владельцев Товарищества Фряновской шерстопрядильной мануфактуры хранится уникальный по своей целостности комплекс фотографий дореволюционного подмосковного Фрянова и его окрестностей. Большинство снимков согласно подписям в альбомах, датируются 19111913 годами. Цифровые копии альбомов для историко-краеведческого музея "Усадьба Фряново" сделаны автором этих строк уже много лет назад. Обилие фотоматериала долгое время будто препятствовало анализу, "не давалось к расшифровке"... Словами старлея Шарапова из кинофильма "Место встречи изменить нельзя": "от целого дня напряженного всматривания глаз, что называется, замыливался; он, чего и не было, видел и, наоборот, не замечал порой того, что вновь появлялось". Точно так и вышло, только с условием, если годами всматриваться...

Работая над подготовкой к изданию 480-страничного фото-бука "Фряново", пересматривая давно, уже более 9 лет как знакомые фотографии, среди их серий обнаружилось изображение простейшей по архитектуре часовни Страстной иконы Божией Матери при деревне Костыши.  Сходство ландшафта, не оставляющее места для сомнений, положение лестницы, существующей до сих пор в том же положении и, может быть, на тех же опорах... Перед нами единственный выявленный на настоящее время (декабрь 2020) фотодокумент, датируемый 1913 годом, отражающий внешний вид деревянной часовни при источнике.


Катание в лодке. Часовня Страстной иконы Божией Матери.  Фотография 1913 г. 

Арх. Залогиных. Единственная выявленная фотография часовни дореволюционного периода.

 

Нельзя не заметить, что по своим "компактным" размерам и реализации Костышевская часовня на фотографии весьма сходна с и поныне существующей часовней в деревне Еремино – памятником деревянного зодчества II пол. XIX в. [cм. temples].

 


Серия фотографий катания на лодке. Арх. Залогиных,
19121913 г. Публикуются впервые.

Часовенный столп 2000 - 2006 гг. постройки у родника в Костышах. Фотографии 2018 г.

 

ОПИСАНИЕ РОДНИКА 1900 г.

В год съёмки фотографии часовни родник в Костышах упоминался в изданном в Москве "Гидрогеологическом очерке Московской губернии". Автором очерка был незадолго до того скончавшийся санитарный врач Московского губернского земства Николай Дмитриевич Соколов (1848–1911). Личность интересная... В 1870 году, в возрасте 22 лет, он арестовывался  по нашумевшему "Нечаевскому делу", послужившему толчком к написанию романа «Бесы» (Ф. М. Достоевский).

 

Н. Д. Соколов и составленная им Гидрографическая карта 1911 г.

 

Между прочим, описывая артезианские водные горизонты, Н. Д. Соколов писал: "Очерчивая восточную границу  "фиолетового" горизонта, необходимо указать на д. Степаньково, расположенную на севере Богородского уезда, в несомненной области распространения меловых отложений. Здесь дно колодца лежит на уровне 170–180 метров, а родник у с. Костыши, в близком отсюда расстоянии на юг, на уровне 167 метров. Между прочим, Степаньково представляет интерес в том отношении, что является вполне показательным, как граница распространения "паромоновской" глины и "фиолетового" горизонта. Здесь на западном, верхнем, конце селения, почти рядом с ним, расположена барская усадьба, имеющая высоту 213 метров [над ур. моря], с колодцем во 40 аршин, то есть дно его расположено на уровне 186 метров ("паромоновская" глина). Само же селение, при устье устроенного здесь колодца, имеет высотную отметку в 200 метров, а глубина колодца 15,2/3 сажени, что равняется абсолютной высоте 168 метров, то есть отвечает уровню выхода родника под с. Костыши ("фиолетовый" горизонт)" [11].

 


 

Фрагмент Гидрографической карты Н. Д. Соколова с ук. Костыши (Никольское) 1911 г. 

В верхней части по центру.

Издание Н. Д. Соколова было снабжено гидрогеологической картой Московской губернии (см. целиком.). Из интереснейших для краеведов северо-востока Подмосковья полевых дневников экспедиций  Н. Д. Соколова и Л. С. Вагина, включавших гидрогеологическое описание села Муромцево (Красноармейск), и ныне не существующих поселений на территории полигона НИИ "Геодезия" (Лукьянцево и Коськово с дачей Страстного монастыря (с. 119, 144-145)), следует, что родник в Костышах обследовался учёными 17 (30) июня 1900 года. В дневнике экспедиции (Л. С. Вагин) указывалось: "В усадьбе д. Степаньковой имеется колодезь (до дна 40 арш.). Вода держится весь год. Из профиля местности видно, что его следует отнести к верхнему, развитому здесь, горизонту, тогда как "святой" [так] колодезь под д. Костыши должен быть отнесен к нижнему горизонту" [12].

 

Записи дневника от 16 июня 1900 года, описывающие поселения по берегам речки Вори в наши дни представляют собой настоящую "игру в краеведческую угадайку" с упоминаниями некой деревни "Марьиной" (предположительно - д. Мишнево), деревни Грамниково (Громниково), села Никольского (Здехова) с химическим заводом при нём(?!),  некого"святого колодезя" и пруда, принадлежавшего Николо-Берлюковскому монастырю [см. прим. 13].


Костыши, август 2018 г. 

 


Дорога от Костышей к Мосальскому, август 2018 г. 

 


На въезде в деревню со стороны Мосальского, август 2018 г.  

 


 

Между д. Степаньково и Костышами. Август 2018 г.  

 

 

ПРЕДАНИЯ О ПОЯВЛЕНИИ РОДНИКА И СТРАСТНОЙ ИКОНЫ БОЖИЕЙ МАТЕРИ

До наших дней дошло несколько любопытных преданий о появлении родника. В некоторых из них оно связано с обретением резной Страстной иконы Божией матери, ранее хранившейся в Никольской(?) часовне при роднике.

 


 

Страстная икона Божией Матери. Фотография А. Послыхалина, сентябрь 2015 г.

 

Наиболее распространённый тип предания приведён анонимным автором в компилятивном издании "Православные храмы. Путешествие по святым местам:

"Этот образ попал в церковь села Маврино из расположенной неподалеку деревни Костыши. По преданию, впервые он был явлен людям на исходе XVI столетия, причем в очень необычном месте  – на ветвях большого дерева, что росло в здешнем лесу. Обстоятельства, при которых это произошло, были драматическими: в округе началась эпидемия холеры, которая, как косой, выкашивала население целыми деревнями. Один из местных крестьян, имени которого история не сохранила, был благочестив и богобоязнен. Свято веруя, он регулярно отправлялся в лес помолиться у чудесного образа Пресвятой Богородицы, прося о защите своей семьи от морового поветрия (так прежде называли на Руси чумные и холерные эпидемии). Горячие мольбы его были услышаны: страшная смерть обошла стороной весь его род, и к дереву с чудотворной иконой устремились отчаявшиеся жители окрестных селений. Образ трижды являлся людям, после чего рядом открылся чистый источник, вода которого оказалась целебной. Крестьяне возвели возле источника часовню, в которой отслужили молебен Владычице Небесной. <...> После того как часовня, где сохранялся чудотворный образ, обветшала, селяне решили передать ее в ближайший храм в селе Маврино. Местное предание повествует, что поначалу икона всякий раз возвращалась из Маврина обратно, чудесным образом оказываясь поутру в своей часовне, пока здание не разобрали на дрова. Лишь тогда она осталась во Владимирском храме. 

Рассказывают, что место, где прежде стояла часовня, по-прежнему не зарастает деревьями и даже кустами – там и ныне круглая поляна, поросшая лишь невысокой травой. <...>

Даже упокоившись во Владимирском храме, икона иногда чудестным образом покидала его на время, дабы оказать Божественную помощь страждущим. Как правило, это чудо происходило во времена эпидемий, когда же болезнь отступала, икона всегда возвращалась на свое место во Владимирской церкви. <...> Одна из историй повествует о том, как местный крестьянин увидел Страстную икону Пресвятой Богородицы в чистом поле, чудесным образом летящей по воздуху" [14].

Предание о том, что икона нередко "покидала храм" связано с массовыми крестными ходами, действительно нередко проводившимися в крае во II половине и конце XIX в. Так, на одной из фотографий рубежа XIX и ХХ вв. из архива ИКМ "Усадьба Фряново" недавно удалось рассмотреть Страстную икону посреди процессии у стен Фряновского храма Иоанна Предтечи.

 

 

 

 

 

Крёстный ход во Фрянове с иконой из Маврина. Фотография кон. XIX – нач. ХХ в. 

Арх. ИКМ «Усадьба Фряново». В сети публикуется впервые. Фрагмент.

 

На фотографии заметно, что икона украшена цветочной гирляндой. О. Н. Глазунова указывала, что "...до недавнего времени [ок. 2004 г.] принято было ярко раскрашивать ее перед каждым праздником: румянить щеки, красить губы и т.д. Лишь несколько лет назад предыдущий мавринский батюшка распорядился прекратить эту традицию и смысл с иконы большую часть "декоративной косметики". По свидетельству прихожан, теперь она выглядит лучше, а то раньше ее даже "трудно было рассмотреть". Сейчас икона в окладе, "отдета в ризы". Раньше было принято "одевать" и убирать ее перед праздником в нарядную (тканую) одежду, и она "как будто радовалась". По общему мнению, "одетая в ризы" она как бы застыла, живое общение с ней стало труднее" [10].

 

Вышеприведённая датировка появления иконы (кон. XVI в.) справедливо была оспорена исследователями К. Т. Сергазиной и П. Г. Чистяковым, склонными относить появление иконы ко временам чумной эпидемии в Москве 17711773 годов. Описывая местные предания, связанные с появлением иконы, исследователи приводят данные местной жительницы Клавдии Александровны Степаковой (1930 г.р.), согласно которым, "Страстная икона была пожертвована в церковь местной помещицей, а начало почитания иконы было связано с исцелениями во время эпидемии" [15]. В контексте этого ценного воспоминания представляется возможным вспомнить об участии в строительстве часовни статской советницы Елизаветы Семеновны Смольянской, однако, исследователи обошли вниманием этот интересный сюжет.

 

Сотрудник Института археологии РАН Ольга Николаевна Глазунова, основываясь на воспоминаниях местных старожилов, склонна выделять две основные версии легендарного происхождения Страстной иконы. Согласно первой, "...икона была оставлена здесь каким-то богатым дворянином в 1812 г. во время поспешного отъезда из Москвы". По второй версии, рассказанной Александрой Филипповной Новоселовой (1930 г.р.) из д. Костыши, "Божья Матерь по речке по Дубенке приплыла. Здесь ее остановили и вырыли ей колодчик. Отсюда ее взяли в Маврино" [16]. Здесь же приводятся данные, сообщенные А. Ф. Новоселовой, Верой Сергеевной Саржиной (1951 г.р.; с. Маврино), Клавдией Ивановной Варфоломеевой (1924 г.р.; д. Костыши), уп. выше Р. Г. Приклоновой и Клавдией Александровной Комаровой (1927 г.р.; д. Костыши). Согласно этим сведениям, объединённым О. Н. Глазуновой, по, опять же, первой версии, "...В 1771 г. во время чумы или холеры вымерло всё сельцо. Остался один человек по фамилии Приклонов, который дал обет перед этой иконой, что если останется жив, то построит часовню напротив колодца. Он выжил, дал начало новому поколению деревни и построил часовню", а по второй "...в это место свозили заболевших чумой. Одному из них, страстно молившемуся о выздоровлении, икона будто бы явилась в ветвях дерева"...

 

Послыхалин А. Ю. © 2020. При использовании материала обязательна ссылка: интернет-журнал "Подмосковный краевед" (trojza.blogspot.com)

 

1.  См.: Скворцов Н. А. Уничтоженные в Богородском уезде церкви. – М., 1901, с. 20-21 (№ 22). А также: Холмогоровы В. и Г. Исторические материалы о церквях и селах XVI–XVIII ст. Вып. V (Радонежская десятина). – М., 1886, с. 112-115 (№ 38). Любопытно, что авторы "Исторических материалов", не знали о былом упразднении храма.

2. Скворцов Н. А. Ibid, с. 21.

3. Савелов Л. М. Московское дворянство в 1812 году. – М., 1912, с. 199.

4. Глазунова О. Н. Цикл местночтимых пятничных праздников на северо-востоке Московской области. // Живая старина. Журнал о русском фольклоре и традиционной культуре. – 2008, № 2(58). – С. 18. Скачать номер.  Прим. А. П.: исследователь неверно определила местоположение родника. По её словам он находится "за северной окраиной деревни в овражке, впадающем в речку дубенку. Называется он Никольским, что, по-видимому, связано с когда-то стоявшей в селении церковью, да и само селение называлось тогда Никольским" (с. 18). Между тем родник находится именно на пб ручья Бродок (пп р. Дубенки), впадающей в Дубенку к СЗ от д. Костыши (см. карты ТКМ 1959 и МО 1982). Впрочем, на более старых картах (напр. РККА 1929 (1941)) Бродок ошибочко ук. как р. "Лубянка" (Дубенка). Более точны в этом вопросе авторы справочника "500 родников Подмосковья" (2006 г.), верно помещая родник на р. Бродок (см. примечание 5).
5. Родник, святой источник иконы Божией Матери Страстная деревня Костыши. // Балабанов И. В., Смирнов С. А. 500 Родников Подмосковья.  – М., 2006. (см.).

6. Демково болото

способов взаимодействия Escherichia coli Dps с ДНК по данным атомно-силовой микроскопии

Abstract

Многофункциональный белок Dps играет важную роль в ассимиляции железа и решающую роль в упаковке бактериального генома. Его мономеры образуют додекамерные сферические частицы, накапливающие ~ 400 молекул окисленных ионов железа внутри белковой полости и применяющие гибкие N-концевые концы каждой субъединицы для взаимодействия с ДНК. Осаждение железа - это хорошо изученный процесс, с помощью которого клетки удаляют токсичные ионы Fe 2+ из генетического материала и сохраняют их в легкодоступной форме.Однако способ взаимодействия с линейной ДНК оставался загадкой, а бинарные комплексы с Dps до сих пор не охарактеризованы. Широко распространено мнение, что Dps связывает ДНК без какой-либо последовательности или структурных предпочтений, но несколько линий доказательств продемонстрировали его способность дифференцировать экспрессию генов, которая предполагает определенную специфичность. Здесь мы показываем, что Dps имеет различное сродство к двум фрагментам ДНК, взятым из регуляторной области гена dps . С помощью атомно-силовой микроскопии мы обнаружили, что Dps преимущественно занимает термодинамически нестабильные концы линейных двухцепочечных фрагментов ДНК и имеет высокое сродство к центральной части разветвленной молекулы ДНК, самоорганизующейся из трех одноцепочечных олигонуклеотидов.Было высказано предположение, что Dps предпочитает связывание с теми областями в ДНК, которые обеспечивают больше контактных площадок для триады его ДНК-связывающего пучка, связанного с одной вершиной белковой глобулы. Насколько нам известно, это первое исследование, в котором был обнаружен нуклеоидный белок со сродством к разветвленной ДНК, типичным для участков генома с прямыми и инвертированными повторами. Поскольку такие структурные элементы являются повсеместной особенностью бактериальных и эукариотических геномов, они требуют особого внимания, но белковая система, эволюционно адаптированная для этой функции, еще не известна, и мы предлагаем Dps в качестве предполагаемого компонента этой системы.

Образец цитирования: Мелехов В.В., Швырева Ю.С., Тимченко А.А., Тутукина М.Н., Преображенская Е.В., Буркова Д.В. и др. (2015) Режимы взаимодействия Escherichia coli Dps с ДНК по данным атомно-силовой микроскопии. PLoS ONE 10 (5): e0126504. https://doi.org/10.1371/journal.pone.0126504

Академический редактор: Дипанкар Чаттерджи, Индийский институт науки, ИНДИЯ

Поступила: 17 ноября 2014 г .; Одобрена: 2 апреля 2015 г .; Опубликован: 15 мая 2015 г.

Авторские права: © 2015 Melekhov et al.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника

Доступность данных: Все данные содержатся в бумага.

Финансирование: Работа поддержана Российским научным фондом (ОНО, грант 14-04-00985, http://rscf.ru/node/8), Министерством образования и науки Российской Федерации ( SSA, проект № 2504, http: // xn - 80abucjiibhv9a.xn - p1ai) и Российского фонда фундаментальных исследований (ONO, 13-04-00997, http://www.rfbr.ru/rffi/eng). Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Введение

Все живые организмы используют определенные структурные белки, чтобы поддерживать свои геномы в функциональном состоянии и защищать их от повреждений различными физическими, химическими факторами и факторами окружающей среды.У эукариот основная ответственность за реализацию функциональности в безопасных условиях лежит на пяти положительно заряженных гистоновых белках, которые конденсируют или расслабляют определенные геномные локусы, взаимодействуя с ДНК без специфичности последовательности. У прокариот эту функцию выполняют 10–12 очень распространенных белков [1–3], которые взаимодействуют с ДНК, распознавая структурные особенности двойной спирали или даже связываясь со специфическими мотивами последовательностей в бактериальной хромосоме.

Всего около 170 000 молекул различных белков заботятся о структуре E . coli при экспоненциальном росте, а переход в стационарный режим сопровождается увеличением их количества до ~ 290 000 [1]. В быстрорастущих клетках наиболее распространенным нуклеоидным белком является Fis ( F Actor of и nversion s timulation), количество которых достигает 60 000 молекул на клетку. В голодных клетках внутриклеточный уровень Fis падает, в то время как доминирующим белком становится Dps ( D NA-связывающий белок p из клеток s tarved, 180 000 молекул на клетку) [1].Fis и по крайней мере четыре других структурирующих белка (IHF, Lrp, H-NS и его паралог StpA) распознают сайты, для которых может быть выведен консенсусный мотив [1, 4-7]. Два других нуклеоидных белка (CbpA и CbpB), а также H-NS и StpA связывают изогнутую ДНК [8–10]; в то время как HU ( H съедает стабильный белок и ) может образовывать комплексы с широким спектром различных геномных локусов, включая изогнутую, неупорядоченную, разорванную или крестообразную ДНК [11–13]. Информация о взаимодействии Dps с ДНК менее достоверна.Считается, что он образует только неспецифические комплексы с отрицательно заряженным сахарно-фосфатным остовом [1, 14–16].

Большинство архитектурных белков бактериального нуклеоида действуют как гомо- или гетеродимеры (Fis, HU, CbpA, IHF, H-NS и StpA). DnaA и CbpB (Rob) действуют как мономеры, в то время как Lrp и Dps могут образовывать большие олигомерные частицы. В этой паре Lrp ( L , реагирующий на эвцин, r egulatory p rotein) существует как смесь димеров, октамеров и гексадекамеров, равновесие которых зависит от присутствия лейцина, благоприятствующего конфигурации октамера.Сегмент ДНК, содержащий сайт связывания Lrp, оборачивается вокруг этого октамера, образуя структуру, подобную нуклеосоме [17]. Доминирующей олигомерной формой Dps является додекамер, который собирается из димеров [18] или тримеров [19]. Додекамеры прочно связываются с ДНК, но способность более мелких олигомеров образовывать аналогичные комплексы еще не была хорошо документирована.

Два белка, которые взаимодействуют со специфическими последовательностями в ДНК (Fis и Lrp), имеют классические ДНК-связывающие домены спираль-поворот-спираль [20, 21]; в то время как большинство нуклеоидных белков полагаются на «косвенное считывание», т.е.е. используют разные структурные модули для распознавания их сайтов связывания в зависимости от конформационных особенностей, опосредованных последовательностью [22–24]. В Dps E . coli эта функция в первую очередь приписывается гибким N-концевым хвостам [16], содержащим три остатка лизина в положениях 5, 8 и 10 и остаток аргинина в положении 18. Делеция первых 8 или 18 аминокислот резко снизилась. способность Dps связывать ДНК и агрегировать с другими молекулами Dps [15], но рентгеноструктурный анализ не выявил типичных ДНК-связывающих модулей на N-концевых концах или каких-либо других сегментах на поверхности белка [16].Таким образом поражает близость E . coli Dps к ДНК в настоящее время понимается как сильное электростатическое взаимодействие между положительно заряженными боковыми цепями гибких белковых модулей и отрицательно заряженным остовом ДНК.

Отсутствие N-концов (как у MsDps1 из Mycobacterium smegmatis [18, 19]) или их пониженная гибкость (как у MsDps1 из M . smegmatis [18], Dps Agrobacterium tumefaciens [25]). ] и молекулы DpsA / DpsB Lactococcus lactis [26]) изменили способ взаимодействия или снизили способность связывания / конденсации ДНК [27].Таким образом, в Dps A . tumefaciens N-концов иммобилизуются на поверхности додекамеров сеткой водородных связей и солевых мостиков, вызывая ингибирование их способности связывать ДНК [25]. В обоих L . lactis Dps белки на N-концах образуют короткие α-спирали [26], выступающие на поверхности белка, и связывают соседние субъединицы через солевые мостики и водородные связи. Эти α-спирали стабилизируют додекамерную структуру белка, а также участвуют во взаимодействии с ДНК, поскольку удаление первых 20 аминокислот из DpsA нарушает способность связывания ДНК.Но замена трех Lys в положениях 9, 15 и 16 на Glu не повлияла на взаимодействие с ДНК [26], вероятно, потому, что эти остатки в структуре α-спиралей «либо обращены, либо расположены параллельно» поверхности додекамера [ 26]. Dps-гомолог Helicobacter pylori (HP-NAP) не содержит положительно заряженного N-конца, но вместо этого имеет положительно заряженную поверхность белка, которая напрямую взаимодействует с молекулами ДНК [28]. Таким образом, способ связывания Dps-ДНК может отличаться для молекул Dps от разных бактерий, но электростатические взаимодействия, скорее всего, играют решающую роль в этих процессах.

Существует четыре теоретических модели, описывающих E . coli Взаимодействие Dps-ДНК на субмолекулярном уровне. Они основаны на данных, полученных с помощью электронной [14, 26, 29–32] или атомно-силовой [15, 18, 28] микроскопии с ограниченным разрешением. Первый был предложен Almiron et al. [14] для объяснения электронных микрофотографий E . coli Dps: комплексы ДНК, наблюдаемые как высокоупорядоченные двумерные сотовые массивы [14, 29].Модель предполагает образование двух связанных гексамерных колец мономеров Dps вокруг двойной спирали ДНК. Однако ДНК-индуцированная конформационная перестройка сферических додекамерных частиц или сборка гексамерных колец из димеров или тримеров еще не зарегистрированы. Вторая модель основана на наблюдении крупных сокристаллов Dps-ДНК [30, 31]. Это предполагает способность Dps образовывать стопку чередующихся слоев, внутри которых ДНК изолирована в полостях между соседними додекамерами.Такие сокристаллы были обнаружены в голодных клетках, содержащих огромное количество Dps [30], и имеют решающее значение для защиты ДНК от множества повреждающих агентов. Однако в экспоненциально растущих клетках Dps был обнаружен как белок, равномерно распределенный по всему нуклеоиду [33].

Третья модель учитывала тот факт, что при физиологических значениях pH как внешняя, так и внутренняя поверхности глобулы Dps заряжены отрицательно (IP = 6,01). Итак, белок должен отталкивать, а не привлекать ДНК. Поскольку присутствие ЭДТА ингибирует связывание ДНК, было высказано предположение, что это взаимодействие опосредуется мостиками, образованными ионами металлов между отрицательно заряженной поверхностью белка и скелетом ДНК [30–32, 34, 35].Хотя эта модель не учитывает функциональность положительно заряженных N-концов, ее, вероятно, можно рассматривать как наиболее универсальную, поскольку несколько линий доказательств указывают на зависимость образования комплекса Dps-ДНК от Mg 2+ [30–32, 34] или Fe 2+ [35]. Наконец, модель, предложенная К. Зетом [36], подчеркивает способность Dps к неспецифическому связыванию ДНК и предполагает, что ДНК навивается вокруг округлой додекамерной частицы гистоноподобным образом.

Нуклеоидные белки с последовательностью или структурной специфичностью участвуют в дифференциальной регуляции генов [37].Такая информация для Dps в основном отсутствует. Тем не менее, было задокументировано, что dps -нулевой мутант E . coli имел значительные изменения в профиле белка [14], и микроматричный анализ был проведен для мутанта dps -null S . enteritidis [38] выявил сотни генов с dps -зависимой транскрипцией. Мы также обнаружили, что делеция dps влияет на транскрипцию определенных генов, оставляя экспрессию других геномных локусов E . coli без изменений [39]. Все эти факты предполагают некоторую специфичность связывания Dps-ДНК, и здесь мы попытались пролить свет на эту проблему с помощью трех разных подходов, используя фрагменты ДНК разной длины, последовательности и структурной организации. Наша цель была подкреплена тем фактом, что Dps - уникальный белок в семействе структурирующих факторов, обеспечивающих не только физическую, но и химическую защиту от повреждающих агентов. Высококонсервативный ферроксидазный центр Dps обеспечивает секвестрацию токсичных ионов Fe 2+ , что позволяет избежать образования гидроксильных радикалов с помощью химии Фентона [40].Окисленные ионы железа затем накапливаются внутри белковой полости и могут высвобождаться при восстановлении. Эта полость может вместить более 400 оксидов железа и может содержать оксиды других металлов, которые изменяют ферромагнитные свойства минерализованного ядра. Итак, сейчас Dps рассматривается как весьма перспективная биомолекула для наноэлектроники, дающая возможность создавать наноустройства с калиброванными ферромагнитными частицами [41]. Некоторая специфичность в его способе взаимодействия с ДНК может быть очень благоприятной при разработке новых материалов с предсказуемым расположением этих частиц.

Материалы и методы

Очистка ДПС

Модель E . Ген coli dps амплифицировали с праймерами TAATTTCTAGAACATAACATCAAGAGG и AGCTCTAGATTTATTCGATGTTAG и клонировали в вектор экспрессии pGEMΔXba [42] с использованием сайта Xba I. Нуклеотидную последовательность рекомбинантного гена, которая не была модифицирована какой-либо меткой, проверяли прямым секвенированием. Экспрессия гена осуществлялась в E . coli BL21 (DE3) клетки, выращенные в среде LB в присутствии ампициллина (100 мкг / мл) при 37 ° C.Транскрипцию рекомбинантного гена индуцировали 0,02 мМ IPTG при OD600 0,4–0,6, и накопление белка позволяли в течение 12 часов. Его очищали с помощью ионообменной хроматографии (DEAE-Sephadex A-25, GE Healthcare, Швеция) и гель-фильтрации на Sephadex G-200 (Pharmacia, Швеция). Белок концентрировали на колонках Vivaspin 20 (Sartorius, Германия), диализовали против буфера для хранения, содержащего 50 мМ трис-HCl (pH 8,0), 50 мМ NaCl, 0,1 мМ EDTA, 5% глицерина, и хранили в морозильной камере.Конечная чистота нативного белка была выше 95%.

Получение фрагментов ДНК

линейных фрагментов ДНК получали с помощью ПЦР с использованием геномной ДНК E . coli K12 MG1655 и праймеры (Евроген, Россия), перечисленные в таблице 1. После ПЦР эти фрагменты ДНК очищали от субстратов и праймеров с помощью 5% -ного ПААГ-электрофореза, экстрагировали и растворяли в воде milliQ. Концентрацию фрагментов ДНК определяли на спектрофотометре ND-1000 (NanoDrop Technologies Inc., СОЕДИНЕННЫЕ ШТАТЫ АМЕРИКИ).

Разветвленные молекулы ДНК были образованы из двух или трех одноцепочечных олигонуклеотидов (Таблица 1), сконструированных таким образом, что каждая половина одного фрагмента была комплементарной половинкам одного или двух других фрагментов (Таблица 1). Олигонуклеотиды растворяли в 5 мМ растворе MgCl 2 , плавили отдельно при 97 ° C в течение 5 минут, смешивали и дополнительно инкубировали при 97 ° C в течение 5 минут. Затем смесь переносили на водяную баню с температурой 70 ° C на 10 минут и давали постепенно остыть до комнатной температуры (4–5 часов).

Анализ сдвига электрофоретической подвижности

Комплексы

ДНК-Dps получали смешиванием фрагментов ДНК с Dps в различных молярных соотношениях в 10 мкл буфера, который содержал 50 мМ Трис-HCl (pH 7,5), 0,1 мМ EDTA и 50 мМ NaCl. Образованию комплекса давали возможность в течение 30 минут при 37 ° C. Эффективность связывания оценивали с помощью анализа сдвига геля, как описано в [43]. Электрофоретическое фракционирование проводили в 5% ПААГ в буфере ТВЭ (89 мМ Трис-HCl, 89 мМ Борная кислота, 2 мМ ЭДТА, pH 8.0) при 200–250 В и 70–110 мА. Полосы ДНК окрашивали бромидом этидия или AgNO 3 .

Следы ДНКазы I

5’-концы праймеров dps _F1 и dps _R2 (таблица 1) были мечены 32 P с использованием полинуклеотидкиназы Т4 (Thermo Scientific, Литва) и протокола производителя. ПЦР амплифицировали три фрагмента ДНК с парами праймеров 32 P- dps _F1— dp s_R1, dps _F1 - 32 P- dp s_R2 и dps _F2 - dps _R2.Амплифицированные фрагменты экстрагировали из геля, как описано в [44]. Перед образованием комплекса образцы ДНК (1 пмоль на реакцию) инкубировали в течение 10 минут при 37 ° C в 30 мкл буфера для транскрипции, содержащего 50 мМ Трис-HCl (pH 8,0), 0,1 мМ EDTA, 0,1 мМ DTT, 10 мМ MgCl 2 , 50 мМ NaCl и 5 мг / мл БСА (Sigma, США). Затем добавляли белок Dps в 2–10-кратном молярном избытке и оставляли взаимодействие в течение 40 минут при 37 ° C. Затем образцы обрабатывали 1 мкг / мл ДНКазы I в течение 2 минут.Расщепление прекращали добавлением 35 мкл 8 М ацетата аммония. Продукты переваривания ДНКазой 1 осаждали этанолом, растворяли в формамидном буфере [44] и наносили на 6% денатурирующий полиакриламидный гель. Образцы фракционировали в буфере TBE и визуализировали с помощью радиоавтографии. Гели калибровали по лестнице G-секвенирования.

Пробоподготовка для атомно-силовой микроскопии (АСМ)

Сохраненные растворы очищенных Dps пропускали через колонку Sephadex G-15 (1x5 см 3 ) для удаления любых агрегированных частиц.Собранные фракции разбавляли в буфере, содержащем 50 мМ Трис-HCl (pH 7,5) и 10 мМ NaCl, до конечной концентрации 1 нг / мкл (4,4 нМ додекамеров) и 2 мкл этого раствора наносили на слюду для сканирования. Линейные фрагменты ДНК или Y-образные структуры растворяли в 5 мМ MgCl 2 до концентрации 1 нг / мкл (4-19 нМ). Комплексы Dps с различными фрагментами ДНК формировали при комнатной температуре в буфере: 50 мМ Трис-HCl (pH 7,5), 10 мМ NaCl и 5 мМ MgCl 2 (10 мкл) в течение 30 минут и наносили на слюду.Для образования комплекса использовали трех-десяти молярный избыток линейных фрагментов ДНК или пятидесяти молярный избыток разветвленных молекул. Аналогичным образом готовили контрольные образцы, но без Dps. Все образцы выдерживали на слюде в течение 5 минут, дважды промывали водой в течение 30 секунд, сушили и структуру образовавшихся комплексов анализировали на АСМ Интегра-Вита (НТ-МДТ, Россия) с использованием кантилеверов NSG03 с радиусом кривизны кончика 10 нм и Резонансная частота 47–150 кГц. Измерения проводились в полуконтактном (постукивающем) режиме.Полученные изображения анализировали с помощью программы Nova (NT-MDT, Россия).

Получение разорванной ДНК

Для наблюдения комплексов Dps с ДНК, содержащей одноцепочечные разрывы, 10 мкг плазмиды pET28b обрабатывали никазой Nt.BspD6I [45]. Реакционная смесь (20 мкл) содержала 10 мМ трис-HCl, pH 7,5, 10 мМ MgCl 2 , 150 мМ KCl, 1 мМ DTT и 10 единиц никазы или равный объем буфера для хранения Nt.BspD6I (10 мМ Tris- HCl, pH 7,5, 50 мМ KCl, 0,1 мМ EDTA, 1 мМ DTT, 50% глицерин) для экспериментального или контрольного образца соответственно.Переваривание было разрешено в течение 1 часа при 55 ° C. Плазмидную ДНК немедленно собирали экстракцией фенол-хлороформ, осаждали этанолом и растворяли в воде. Кривые плавления были получены для обеих плазмид, что подтвердило образование трещин. Комплексы с Dps в молярном соотношении Dps: ДНК 5: 1 или 10: 1 получали, как описано выше.

Результаты

Dps имеет разное сродство к двум фрагментам промоторной области

dps

Уже известно, что делеция dps изменила профиль белков в голодном E . coli [14] и изменил профиль транскрипции в S . enteritidis [38] и E . coli [39]. Но этот очевидный регуляторный эффект может быть опосредован взаимодействием с регуляторными белками, занимающими их сайты связывания, которые высвобождаются в мутанте dps -null. Другими словами, данные, полученные in vivo , наводят на размышления, но их недостаточно для отказа от традиционной точки зрения, согласно которой Dps взаимодействует с ДНК без какой-либо специфичности [1–3, 14–16].Мы также ранее обнаружили, что две A / T-богатые области, содержащие « промоторный остров » yeaI и промоторы dps , имеют более высокое сродство к Dps, чем два линейных фрагмента ДНК, представляющих кодирующие последовательности и межгенное пространство, расположенное между конвергентными генами [ 46]. Эти эксперименты были выполнены in vitro , в отсутствие какой-либо конкуренции с регуляторными белками, что увеличивало возможность селективного взаимодействия. Поскольку факторы транскрипции обычно влияют на экспрессию собственных генов, регуляторная область dps была выбрана как наиболее многообещающий кандидат для демонстрации «специфического» связывания.Таким образом, фрагмент 420 п.н., охватывающий регуляторную область гена dps и взаимодействующий с белком Dps, был разделен на две половины. Один (длиной 259 п.н.) был получен методом ПЦР с праймерами dps _F2 и dps _R2 (таблица 1) и включал основной промотор этого гена - P dps [47, 48]. Другой (длиной 214 п.н.) содержал дистальный промотороподобный сайт P3, который демонстрировал низкую транскрипционную активность, но был важен для максимальной экспрессии dps [49].

Поскольку ДНК-связывающая активность Dps обычно сопровождается самоагрегацией, а агрегированные комплексы не попадают в гель [1, 14, 19, 35, 39, 49], эффективность связывания оценивали на основе оставшейся свободной ДНК. несвязанный. Используя смешанные анализы, содержащие обе половины регуляторной области в одном образце, мы обнаружили, что фрагмент с функциональным промотором имеет более высокое сродство к Dps, чем дистальная часть регуляторной области (рис. 1A). Таким образом, стало ясно, что, образуя комплексы со всеми протестированными фрагментами ДНК [39], Dps может с определенной селективностью связываться с промоторной областью собственного гена.Затем мы попытались локализовать сайт связывания Dps в этой области с помощью техники отпечатков ДНКазы I (рис. 1B). Но обнаружив несколько гиперреактивных сайтов и наблюдая четко защищенные R1- и F2-концы (схема на рис. 1C) в обоих небольших фрагментах при большом молярном избытке Dps (10-кратный), при 5-кратном избытке мы обнаружили только несколько защищенных полос (~ 175 и ~ 113 п.н. ниже праймера dps _F1 и в области 120–151 п.н. выше праймера dps _R2). Последний воспроизводимо наблюдался в комплексах как с короткими (F2-R2), так и с длинными (F1-R2) фрагментами, предполагая некоторую специфичность в этом связывании.Вот почему на следующем этапе мы использовали атомно-силовую микроскопию (АСМ) для характеристики общей топологии комплексов Dps-ДНК.

Рис. 1. [A]: Пример анализа сдвига электрофоретической подвижности, выполняемого, как описано в разделе «Материалы и методы».

Один пмоль фрагмента ДНК длиной 214 п.н., амплифицированного с праймерами dps _F1 и dps _R1 (обозначенный как F1-R1), загружали только на дорожку 1 в качестве независимого маркера. Другие образцы содержали два фрагмента (по 1 пмоль каждый) и Dps, как указано выше на фотографии.Гель калибровали по маркерной лестнице (M). [B] Анализы футпринтинга ДНКазы I, выполненные для комплексов Dps с фрагментами ДНК F1-R1, F2-R2 и F1-R2. 32 Р-меченых праймеров отмечены звездочками. Гели калибровали по продуктам лестницы G-секвенирования. Позиционные метки показывают расстояние до 32 P-меченных праймеров F1 или R2. Защищенные сайты отмечены пунктиром. Гиперреактивные сайты не помечаются. [C] : Схема, иллюстрирующая относительное расположение и структурную организацию проанализированных фрагментов.Прямые и инвертированные повторы в их последовательностях усилены и дополнительно обозначены стрелками. Соответствующие полосы в [B] обозначены открытыми и серыми стрелками для прямых и инвертированных повторов соответственно. Изогнутая стрелка указывает сайт начала транскрипции в промоторе P dps .

https://doi.org/10.1371/journal.pone.0126504.g001

Взаимодействуя с линейными фрагментами ДНК Dps обычно связывает концы двухцепочечных молекул

Фиг. 2A демонстрирует изображения очищенного Dps с помощью АСМ.Большинство наблюдаемых частиц имели квазисферическую форму с высотой около 7 нм, что хорошо согласуется с ожидаемым размером [16]. Расчетный вертикальный размер разложенных молекул ДНК составлял 2 нм ( Fig 2B – 2D ) , что также точно соответствует ожидаемому значению. Однако планарные размеры на АСМ-изображениях зависят от конечного размера острия кантилевера (в нашем случае R = 10 нм), а точность их измерения зависит от размера объекта. Таким образом, видимые диаметры белковых частиц в плоской проекции составляли 27–32 нм, кажущаяся ширина двойной спирали ДНК - ~ 21 нм, а длины ДНК-фрагментов 214, 259 и 420 п.н. составляли 76, 93 и 146 нм, т.е. .е. лишь немного больше ожидаемых значений (73, 88 и 143 нм соответственно). Таким образом, длину длинных молекул ДНК можно оценить достаточно точно.

Рис. 2. Изображения АСМ.

[A] : белок Dps; [BD] : ДНК-фрагменты, содержащие соответственно полную регуляторную область гена dps (420 п.н., праймеры dps_ F1 и dps_ R2), его проксимальный (259 п.н., праймеры dps_ F2 и dps_ ). R2) и дистальной (214 п.н., праймеры dps_ F1 и dps_ R1) части.Панели b и c : комплексы, образованные Dps с 214 п.н. (b) и 259 п.н. (c) ДНК-фрагментами. Белые шкалы представляют 100 нм.

https://doi.org/10.1371/journal.pone.0126504.g002

Все образцы белка оказались довольно однородными, обычно содержащие менее 20% частиц меньше, чем додекамеры. Удивительно, но они не были загрязнены фрагментами ДНК, плотное связывание которых составляло , ранее ожидаемое [14, 15], или агрегатами (рис. 2А).Однако образование комплекса с ДНК спровоцировало сильную агрегацию. Удаление агрегатов путем промывки образцов слюды позволило зарегистрировать индивидуальные комплексы Dps как с короткими фрагментами ДНК, так и с использованием анализа сдвига электрофоретической подвижности и отпечатков пальцев (рис. 1). В обоих случаях мы наблюдали взаимодействие белковых частиц с концами молекул ДНК (рис. 2B и 2C). Мы не видели ни одного упорядоченного двумерного массива, зарегистрированного ранее с помощью электронной микроскопии [14, 29–32, 34, 36].Но это было ожидаемо, поскольку такие комплексы никогда не наблюдались с помощью АСМ [15, 18, 28], и мы намеренно удалили агрегаты путем интенсивной промывки. Мы также не обнаружили гексамерных колец, охватывающих ДНК [14], или убедительных доказательств того, что нуклеосомоподобная ДНК обвивается вокруг сферических частиц Dps [36], которые ожидались в рамках существующих моделей. Но мы также не обнаружили большого количества молекул Dps, взаимодействующих с внутренними частями линейных фрагментов ДНК. Даже если такие комплексы могут быть специфически вымыты агрегированным белком, стало ясно, что Dps может связывать концы двухцепочечной ДНК.Поскольку фрагменты F1-R1 и F2-R2 перекрываются на 53 п.н. в их A / T-богатых концах R1 и F1, в то время как две другие области с высоким содержанием A / T соответствуют оставшимся двум областям контакта с Dps (рис. 1B и 1C), мы предположили, что более высокое сродство этого белка к F2- Фрагмент R2 (рис. 1А) тривиально объясняется его более низкой термодинамической стабильностью (65 и 58% для фрагментов F2-R2 и F1-R1 соответственно).

Y-образные разветвленные конструкции - идеальные мишени для Dps

Две конструкции использовали для оценки сродства Dps к A / T-богатой ДНК.Один из них был построен из 2 синтетических олигонуклеотидов Y1 (57 n) и Y3 (64 n) (таблица 1) как искусственная модель концов ДНК. Он имел стабильный G / C-ствол и две гибкие одноцепочечные ветви, одна из которых состояла из аденинов (рис. 3A). Если Dps имеет повышенное сродство к одноцепочечной ДНК, мы ожидали найти его в комплексе с этими одноцепочечными ветвями, в то время как G / C-стебель может выступать из образованных комплексов. Другая конструкция была построена из олигонуклеотидов Y1, Y2 и Y3 (таблица 1) и содержала три ветви.Две длинные ветви в этой молекуле имели только пары оснований G / C, в то время как короткая содержала только пары A / T и могла быть идеальной мишенью для концевого специфического взаимодействия (Рис. 3B). В этом случае мы ожидали найти Dps в конце короткой ветви.

Рис. 3. Комплексы, образованные ДПС с четырьмя искусственными разветвленными конструкциями, схематически тонут на каждом участке.

Последовательность цветных кружков соответствует последовательности использованных олигонуклеотидов (таблица 1). Панели демонстрируют изображения АСМ, полученные для свободных образцов ДНК и их комплексов с Dps (левое и правое сканирование соответственно).Сборку конструкций ДНК и формирование комплекса выполняли, как описано в разделе «Материалы и методы». Вставка на правой панели Рис. D иллюстрирует трехмерное изображение комплексов, образованных триплексом Y5_Y6_Y8. Хорошо видны концы всех трех ветвей. Белые полосы представляют масштабы 100 нм.

https://doi.org/10.1371/journal.pone.0126504.g003

На левой панели на рис. 3А показан пример свободных молекул ДНК, собранных из праймеров Y1 и Y3. Все они выглядят как зерна, но не как молекулы Y-образной формы.Это может быть связано со способностью гуанинов к квазикомплементарному взаимодействию с аденинами и гуанинами. В результате кажущийся продольный размер большинства наблюдаемых частиц составляет около 25 нм, что меньше, чем ожидалось для полностью вытянутого дуплекса (32 * 0,34 + 32 * 0,59 = 29,8 нм). Также возможно, что эти бинарные комплексы по своей сути гетерогенны, поскольку 3'-концевой C Y1 может связывать не только 5'-концевой G Y3, но также и любой другой гуанин в его поли G-последовательности, тем самым создавая смесь разные дуплексы.Однако все они должны содержать хотя бы небольшую часть одноцепочечной ДНК. Помимо зерен длиной 25 нм, мы также наблюдали более мелкие частицы с размером в диапазоне 13–20 нм, которые могут представлять собой одиночные олигонуклеотиды, образующие квадруплексы или другие вторичные структуры.

Добавление Dps изменило структуру этих частиц. Однако вместо обнаружения ожидаемых двухцепочечных спиралей, вытянутых из бинарных комплексов, мы наблюдали 2–4 неупорядоченных одноцепочечных хвоста ДНК (Рис. 3A).Эти хвосты имели видимую длину ~ 14–60 нм. Если принять во внимание ожидаемые ошибки в плоских проекциях, их можно рассматривать как два олигонуклеотида с расчетной длиной 34 и 38 нм, прикрепленные своими концами или внутренними частями к N-концам (или поверхности) Dps, или как одноцепочечные ветви. двух Y-образных молекул, одновременно взаимодействующих с одним белком. В обоих случаях максимальная длина наблюдаемых одноцепочечных хвостов больше, чем одноцепочечных ветвей в правильно собранном дуплексе (15–20 нм), что указывает на то, что начальное связывание Dps с зерноподобными частицами было достаточно сильным, чтобы перестроить их структура и удерживать неупорядоченные молекулы.

разветвленных молекул ДНК на фиг. 3B были собраны из праймеров Y1, Y2 и Y3 (таблица 1). Они сформировали конструкции, напоминающие Y-образную форму (левая панель), но состояли из асимметричного модуля V-образной формы и меньшего домена, связанного с основной частью. Размер этого ассоциата точно соответствовал мелким зернам на рис. 3A, в то время как длина модуля V-формы варьировалась в диапазоне 24–30 нм (ожидаемый размер в самом длинном измерении составлял: 64 * 0,34 = 21,8 нм) и среднее соотношение между двумя сторонами было равно 0.88 (ожидаемое значение: 57/64 п.н. = 0,89). Таким образом, существует вероятность того, что самосборка наблюдаемых частиц происходила через образование комплементарного триплекса, связанного с дуплексом неканоническим спариванием оснований. Электрофоретическое фракционирование этих комплексов действительно выявило две полосы, соответствующие триплексу и дуплексу (рис. 4, дорожка 1). Более короткая сторона V-образного модуля (Рис. 3B), скорее всего, соответствовала A / T ветви, в то время как одна G / C ветвь была конформационно скрыта и могла контактировать с небольшим ассоциатом.Ориентация триплекса по отношению к этому ассоциату была случайной, предполагая, что они собираются независимо от олигонуклеотидов. Смесь собранных молекул также содержала 10–20% более крупных частиц Y-образной формы (длина: 53–62 нм, высота: в среднем 2,6 нм), вероятно, образованных из триплексов и дуплексов, уложенных стопкой из-за квазикомплементарного взаимодействия квадруплексного типа вдоль G-прядь.

Рис. 4. Анализы сдвига электрофоретической подвижности, выполненные для комплексов Dps с Y-образными конструкциями Y1_Y2_Y3 (заглушка на фиг. 1B) и Y5_Y6_Y7 (аналогично Y5_Y6_Y8, утопленная на фиг. 1D, но без однонитевой петли).

Состав образцов и молярное соотношение Dps: ДНК указаны над фотографиями. Молекулы разветвленной ДНК собирали из указанных олигонуклеотидов, смешанных в равных концентрациях (2–5 пмоль каждый), и получали, как описано в разделе «Материалы и методы». Без предварительного фракционирования их использовали для образования комплекса с Dps. Количество Dps было выбрано исходя из предположения, что все олигонуклеотиды образуют триплекс, как в случае Y5_Y6_Y7. Следовательно, указанные молярные отношения для Y1_Y2_Y3 завышены.Гели калибровали с помощью маркерных фрагментов ДНК (M) и окрашивали AgNO 3 , чтобы визуализировать как молекулы ДНК, так и Dps.

https://doi.org/10.1371/journal.pone.0126504.g004

Обе Y-образные структуры взаимодействовали с Dps, но белок в этом случае обнаружен только в центральной части разветвленных искусственных конструкций (правая панель на рис. 3Б). В составных комплексах он не препятствует связыванию с концом A / T- или G / C ветви верхней молекулы.Но небольшие конструкции с кажущимся размером 24-30 нм также не обнаруживают концевого специфического связывания (вставки на правой панели фиг. 3B). Поскольку размер этих конструкций был такой же, как кажущийся диаметр Dps в плоской проекции, они были почти полностью покрыты белком, хотя концы всех трех ветвей были видимыми и идентифицируемыми.

Чтобы сравнить сродство Dps к триплексу Y1_Y2_Y3 и соответствующим бинарным структурам, мы приготовили смесь их самоорганизованных молекул и, без фракционирования, подвергли ее взаимодействию с Dps (дорожки 1-3 на рис. 4).Трехкратный молярный избыток белка был достаточен для связывания всех образованных триплексов, в то время как большинство дуплексов оставалось свободным. Основываясь на этих данных, мы предположили, что Dps может связывать одноцепочечную ДНК и даже плавить двойную спираль (рис. 3A), но разветвленные конструкции, которые обеспечивают дополнительную двухцепочечную платформу для взаимодействия с положительно заряженными N-концами, могут быть более предпочтительными мишенями.

Затем мы обнаружили, что способ взаимодействия, зарегистрированный для конструкции Y1_2_3 (рис. 3B), не был следствием ее конкретной первичной структуры, поскольку молекулы Y-формы строятся из олигонуклеотидов с природными последовательностями Y5, Y6 и Y7 или Y8, образующими один и тот же тип. комплексов.Первая половина Y5 (32 нуклеотида) и последняя половина Y6 были взяты из перекрывающейся части фрагментов F1-R1 и F2-R2 (рис. 1C). Самосборка этих 96 bp-конструкций (пример для Y5_Y6_Y7 на фиг. 4, дорожка 4) была намного более эффективной, чем в случае триплекса Y1_2_3 (фиг. 4, дорожка 1). Поэтому в смеси осталось очень небольшое количество дуплексов. Тем не менее, при 2-кратном молярном избытке белка, когда количество триплексов значительно снижается, несвязанные дуплексы все еще обнаруживаются (дорожка 6).Таким образом, вероятно, что среди разветвленных молекул с одно- и двухцепочечными разветвлениями Dps в основном выбирает последние.

Две модификации были использованы для повышения качества АСМ-изображений, полученных для комплексов Dps с разветвленной ДНК. Во-первых, мы добавили 26 нуклеотидов к 5’-концу Y5 и 3’-концу Y6 (9 нм), чтобы увеличить длину триплекса (Таблица 1 и Рис. 3C). Сайт, защищенный Dps против ДНКазы I, который расположен на 175 п.н. ниже праймера dps _F1 (фиг. 1B и 1C), был таким образом включен в конструкцию.В результате мы наблюдали комплексы с четко видимыми одной или двумя ветвями ДНК (рис. 3С, два правых столбца). В первом случае Dps может быть прикреплен к точке ветвления или к концу одного из коротких плеч, тогда как во втором случае взаимодействие с точкой ветвления кажется более вероятным, но третье плечо было плохо видно. Затем мы заменили динуклеотид TT во внутренней части Y_7 на AA (олигонуклеотид Y8). В результате новый триплекс Y5_Y6_Y8 имел короткую однонитевую петлю в одной ветви. Эта модификация немного сместила связанный белок от центра (рис. 3D), показывая концы всех трех ветвей (см. Трехмерное изображение на рис. 3D).Следовательно, Dps связывает 3-стороннее соединение и, вероятно, обладает определенной специфичностью по отношению к одноцепочечным или гибким участкам ДНК. Если это так, связывание Dps с одноцепочечными разрывами в природной ДНК может вызвать плавление, подобное тому, которое наблюдается на фиг. 3A. Чтобы проверить эту возможность, мы проанализировали комплексы, образованные Dps, с нативной и разорванной плазмидой pET28b.

Одноцепочечные разрывы в природной ДНК не были нарушены Dps

Очищенная плазмида pET28b выглядела как нативная и сильно свернутая молекула (фиг. 5A).Он расщеплялся сайт-специфической никазой Nt.BspD6I, которая распознавала девять последовательностей GAGTC и делала одноцепочечные разрывы в верхней цепи на четыре основания по направлению к 3’-концу [50]. В результате плазмида стала расслабленной и даже фрагментированной (рис. 5В), поскольку несколько сайтов связывания близко расположены в этой ДНК. Комплексы с Dps образовывались при 5- и 10-кратном молярном избытке додекамеров Dps. Более высокое соотношение обеспечивало присутствие комплексов, образованных с разрезанной и неразрезанной ДНК, и позволяло обнаружить их различие, если таковое имеется, в то время как более низкое соотношение давало возможность увеличить долю комплексов, образованных с предпочтительными сайтами.Плотность связанных молекул Dps при 10-кратном избытке белка была выше на разорванной плазмиде по сравнению с нативной: 1 молекула на 117 ± 12 нм против 135 ± 23 нм соответственно (расчетная длина плазмиды 1917 нм). . Хотя разница не была статистически значимой, она соответствовала ожидаемому вкладу зарубок. Однако бинарные комплексы с додекамерами Dps в обоих случаях были очень похожи, и тщательное исследование не выявило одноцепочечных хвостов вблизи связанного белка (рис. 5C и 5D).

Рис. 5. Примеры нативной (A, C) и разорванной (B, D, E) плазмиды pET28b в свободном состоянии (A, B) и образующих комплексы с Dps (C-E) .

Белые полосы изображения в масштабе (нм). Горизонтальные и вертикальные стрелки на панелях C-E указывают комплексы с более низким и более высоким уровнями олигомеризации соответственно.

https://doi.org/10.1371/journal.pone.0126504.g005

Как в нативных, так и в разорванных образцах мы обнаружили примерно 15% комплексов, образованных с частицами Dps, меньшими, чем додекамеры (показаны на рис. 5D горизонтальными стрелками).Следовательно, додекамерная форма не является абсолютно необходимой для взаимодействия с ДНК. Фрагментированные ДНК в большинстве случаев содержат молекулы Dps по крайней мере на одном конце двойной спирали. Таким образом, концевое специфическое взаимодействие с Dps не является специфическим свойством коротких линейных фрагментов ДНК. Образцы с разорванной плазмидой содержали в два раза больше комплексов, образованных с кажущимися агрегированными или каким-то образом перестроенными частицами Dps (30 и 15% соответственно), которые обычно были встроены в матрицу ДНК (вертикальные стрелки на рис. 5C – 5E).Хотя их подробная структура требует специального изучения, уже ясно, что этот способ связывания может вызывать значительные конформационные переходы в ДНК, поскольку сверхспиральный стержень, отчетливо видимый около комплекса 3 (рис. 5E), скорее всего, не может образоваться в исходной плазмиде, имеющей прошли обработку никазой и пробоподготовку.

Обсуждение

Dps - основной белок бактериального нуклеоида, конденсирующий геном и защищающий его от различных повреждений во время устойчивого роста и при различных стрессах.Это означает, что взаимодействие с ДНК является фундаментальной биологической функцией этой молекулы. Решающая роль в связывании принадлежит остаткам лизина, расположенным в положениях 5, 8, 10 и 18 двенадцати N-концевых модулей [15]. Их положительный заряд обеспечивает способность связывать отрицательно заряженную ДНК так же, как гистоны в геномах эукариот. Однако, в отличие от октамера гистонов, сферическая поверхность Dps заряжена отрицательно (рис. 6А). Таким образом, остается загадкой, почему эволюция выбрала этот белок для защитного взаимодействия с ДНК.

Рис. 6. Кристаллическая структура Dps (PDB ID: 1DPS) была получена с разрешением 1,6 Å Грантом и др. [16].

Распределение заряда на поверхности Dps было рассчитано с использованием Swiss-PdbViewer версии 4.1.0 [52]. На панели [A] порог кулоновской окраски поверхности был установлен на -12 для красного (отрицательный электростатический потенциал), на -1,5 для белого и на 0 для синего (положительный потенциал). В панели [C] масштаб был изменен на: -12, -4,8 и 0 соответственно. N-конец цепи «А» был пропорционально удлинен, чтобы схематично показать расположение Lys 5 и Lys 8 (синие шарики).N-концы двух других цепей были удлинены до положения 9 (как в цепи «А»). Серые звездочки в коде [C] обозначают концы гибких модулей. Панель [B] показывает центральную пору и расположение субъединиц около одной и той же вершины. Панель [D] схематически иллюстрирует различные способы взаимодействия, включая связывание с разветвленной ДНК со структурой «соскользнувшая петля» (слева), разорванной ДНК (две правые частицы) и прямой ДНК (вторая справа). В последнем случае два N-конца участвуют в связывании ДНК, а третий из той же вершины может связывать вакантный участок отрицательно заряженного пятна на поверхности другой молекулы Dps.Даже если такие контакты белок-белок могут образовываться в растворе, присутствие ДНК должно стабилизировать их и способствовать агрегации белка. Все размеры молекул на схеме указаны пропорционально натуральным размерам.

https://doi.org/10.1371/journal.pone.0126504.g006

Комплексы с Dps были зарегистрированы для всех типов ДНК, протестированных в этом исследовании, и два новых способа связывания (концевое специфическое связывание и взаимодействие с разветвленной ДНК молекул).Поскольку линейные фрагменты ДНК (рис. 2) или усеченные ДНК (рис. 5) обычно имеют молекулы Dps на конце двойной спирали, мы предполагаем, что специфическое взаимодействие по концам более эффективно, чем связывание Dps с внутренними частями молекул ДНК. Однако искусственные триплексы обгоняли дуплексы в комплексообразовании с Dps (рис. 4, дорожки 1–3), по-видимому, прикрепляя его к внутренней части конструкции (рис. 3). Мы объяснили это предпочтение наличием сайта связывания для дополнительного N-конца в обеих новых мишенях.Поскольку в структуре додекамерных ДНК-связывающих модулей мономеров сгруппированы в триады (рис. 6В), трехстороннее соединение может быть особенно выгодным для образования комплекса, так же, как изогнутые и развернутые ДНК, включая частично расплавленные концы двойной ДНК. спиральные и одноцепочечные разрывы, в то время как взаимодействие с прямой ДНК может быть ограничено всего двумя контактами с N-концом. Если одноцепочечные разрывы являются мишенями для Dps, то уже известная способность этого белка уменьшать их количество в ответ на окислительный стресс [51] может быть опосредована не только физической защитой ДНК, но и его активным участием в связывании с такие дефекты.

Хотя первые 21 аминокислотный остаток в каждой субъединице Dps неструктурированы, 13 из них можно проследить в рентгеновской структуре [16], используя в качестве прототипа полипептидную цепь «A» (обозначенную на фиг. 6B) [16]. Таким образом, ясно, что неструктурированные N-концы довольно длинные и могут участвовать в электростатических взаимодействиях как с отрицательно заряженной ДНК, так и с отрицательно заряженной поверхностью белка. Т.е. они могут прилипать к белку за счет электростатических сил, как это наблюдалось для Dps A . tumefaciens [25] и могут не обнаруживаться в кристаллических структурах либо потому, что они гибкие, как принято считать, либо потому, что их контактные участки случайным образом распределены по всей доступной поверхности. Вот почему способность Dps агрегировать и образовывать олигомерные структуры является его внутренним свойством. Но эта способность в значительной степени стимулируется присутствием ДНК, а бинарные комплексы Dps-ДНК почти никогда не наблюдались в анализах гель-сдвига [1, 14, 19, 34, 39, 49]. Хорошо известно, что основными участниками этого процесса являются те же N-концевые лизины, которые связывают ДНК [15].Таким образом, было высказано предположение, что случайное связывание молекул Dps с ДНК ограничивает их подвижность в пространстве, тем самым увеличивая концентрацию белка в геноме и способствуя межбелковым взаимодействиям [15, 18, 28]. Эта модель очень хорошо объясняет образование крупных агрегатов, часто наблюдаемых с помощью АСМ, но не может объяснить образование высокоупорядоченных двумерных решетчатых массивов [14, 29] и низкую способность свободных Dps агрегировать даже в очень высокой концентрации (см. Рис 2А, например).Наши данные, подчеркивающие важность 3-кратной симметрии, позволили нам предложить другое объяснение сильной зависимости процесса агрегации от присутствия ДНК. Мы предполагаем, что в отсутствие ДНК N-концы Dps не являются полностью свободными. Вместо этого они случайным образом иммобилизуются на отрицательно заряженной поверхности белка. Три сильно заряженных пятна были обнаружены анализом поверхности с помощью Swiss-PdbViewer [52] (рис. 6C). Они расположены на удобном расстоянии от каждого N-конца, обеспечивая идеальную платформу для связывания, что снижает вероятность случайных внешних электростатических контактов.В присутствии ДНК один, два или три ДНК-связывающих модуля каждой вершины могут покинуть свои сайты связывания, освобождая их для контакта с N-концами других молекул Dps, если они расположены на доступном расстоянии. Две левые частицы на рис. 6D иллюстрируют эту ситуацию. То есть, с нашей точки зрения, присутствие ДНК стимулирует белок-белковые связи за счет перераспределения электростатических контактов. Те из них, которые стабилизировали целостность додекамера без ДНК, вызывают агрегацию в новых условиях.

Способность Dps распознавать разветвленную двухцепочечную ДНК может иметь даже большее биологическое значение. В настоящее время известна только одна система в E . coli , который распознает и обрабатывает такие разветвленные структуры, как соединения Холлидея. Эти четырехсторонние соединения образуются во время рекомбинации и репарации ДНК и разрешаются системой, состоящей из трех белков - RuvA, RuvB и RuvC, где октамерная геликаза RuvA специально «скульптурирована» для взаимодействия с крестообразной ДНК [53].Трехсторонние соединения могут быть сформированы в любом сегменте ДНК, содержащем по крайней мере два прямых повтора, где могут быть сформированы два типа структур со скользящими петлями (SLS, проиллюстрированные на рис. 6D) [54]. В бактериальных геномах есть тысячи таких мест, включая кластеры регулярно расположенных коротких палиндромных повторов (CRISPR), принадлежащих бактериальной «иммунной» системе и тандемам сайтов связывания факторов транскрипции. В промоторной области гена dps , например, есть четыре пары коротких прямых повторов, две из которых перекрываются с первичным сайтом контакта для Dps (рис. 1B и 1C).Структурное состояние участков генома с тандемными повторами должно находиться под особым контролем клеточных регуляторных систем. Но система, эволюционно адаптированная для этой функции, еще не известна, и бактериальный Dps может быть предложен в качестве кандидата на эту функцию. Его сродство к 3-стороннему соединению и способность вызывать конформационные изменения в ДНК (рис. 1B, 3A и 5E) являются весомыми аргументами в пользу такой возможности. Однако способность Dps к агрегации, которая в основном важна для конденсации генома в стрессовых условиях, может мешать тонкому функционированию, необходимому для управления структурным ландшафтом в активном геноме.

Есть один аспект, который также заслуживает некоторого внимания: если ДНК связана тремя N-концами одной вершины, что считается наиболее сильным способом взаимодействия, центральная пора белковой глобулы ведет во внутреннюю полость (рис. 6С), вплотную приближается к генетическому материалу. Даже небольшая утечка токсичных ионов железа из этой поры может разрушить целостность генома. Таким образом, вероятно, что, защищая ДНК от различных повреждающих агентов и удаляя токсичные ионы железа из геномной среды, Dps также может участвовать в структурно-специфическом разрушении нуклеиновых кислот.

В любом случае наши данные показали, что очищенный Dps E . coli собирается в стабильные додекамерные частицы с некоторым вкладом более мелких олигомеров. Взаимодействуя с ДНК, додекамерная форма Dps продемонстрировала определенную концевую специфичность и высокое сродство к трехстороннему соединению в искусственных молекулах ДНК. Поскольку связывание Dps с ДНК в основном осуществляется за счет электростатических взаимодействий, нет оснований исключать, что Dps также может образовывать комплексы с РНК, влияя на их функциональные свойства или стабильность, тем более что уже сообщалось, что «структуры кораллового рифа», образованные Dps2 М . smegmatis может разрушаться РНКазой А [55]. Таким образом, репертуар многофункционального белка Dps может быть даже шире, чем предполагалось в настоящее время.

Благодарности

Мы хотели бы выразить благодарность Геннадию Енину из Института исследования белков Российской академии наук (РАН) за то, что он поделился с нами своим опытом в АСМ в ходе исследования, и Надежде Зыриной из Института теоретических и экспериментальных исследований. Biophysics, РАН за любезное предоставление Nt.Никаза BspD6I.

Вклад авторов

Задумал и спроектировал эксперименты: ONO SSA AAT. Проведены эксперименты: VVM USS MNT EVP DVB SSA. Проанализированы данные: ONO SSA AAT VGA. Предоставленные реагенты / материалы / инструменты анализа: ONO SSA VGA. Написал статью: ONO SSA.

Ссылки

  1. 1. Азам Т.А., Исихама А. Двенадцать видов нуклеоид-ассоциированного белка из Escherichia coli . Специфичность распознавания последовательностей и аффинность связывания ДНК.J Biol Chem. 1999; 274: 33105–33113. pmid: 10551881
  2. 2. Дорман CJ. Связанные с нуклеоидами белки и физиология бактерий. Adv Appl Microb. 2009. 67: 47–64. pmid: 19245936
  3. 3. Азам Т.А., Ивата А., Нишимура А., Уэда С., Исихама А. Зависящие от фазы роста изменения в белковом составе нуклеоида Escherichia coli . J Bacteriol. 1999; 181: 6361–6370. pmid: 10515926
  4. 4. Гудман С.Д., Фельтен Нью-Джерси, Гао К., Робинсон С., Сегал А.М. In vitro выбор сайтов связывания факторов хозяина интеграции. J Bacteriol. 1999; 181: 3246–3255. pmid: 10322029
  5. 5. Чо Б.К., Найт Э.М., Барретт К.Л., Палссон Б.О. Полногеномный анализ связывания Fis в Escherichia coli указывает на причинную роль A- / AT-трактов. Gen Res. 2008. 18: 900–910.
  6. 6. Чо Б.К., Барретт К.Л., Найт Е.М., Парк Ю.С., Палссон Б.О. Реконструкция в масштабе генома регуляторной сети Lrp в Escherichia coli .Proc Natl Acad Sci USA. 2008; 105: 19462–19467. pmid: 135
  7. 7. Bouffartiques E, Buckle M, Badaut C, Travers A, Rimsky S. Кооперативное связывание H-NS с высокоаффинными сайтами в регуляторном элементе приводит к подавлению транскрипции. Nat Struct Mol Biol. 2007. 14: 441–448. pmid: 17435766
  8. 8. Ueguchi C, Kakeda M, Yamada H, Mizumo T Аналог молекулярного шаперона DnaJ в Escherichia coli . Proc Nati Acad Sci USA. 1994; 91: 1054–1058.pmid: 8302830
  9. 9. Bloch V, Yang Y, Margeat E, Chavanieu A, Auge MT, Robert B et al. Домен димеризации H-NS определяет новую складку, способствующую распознаванию ДНК. Nat Struct Mol Biol. 2003; 10: 212–218.
  10. 10. Зонненфилд Дж. М., Бернс К. М., Хиггинс К. Ф., Хинтон Дж. К. Д. Связанный с нуклеоидом белок StpA связывает изогнутую ДНК, имеет большую аффинность связывания ДНК, чем H-NS, и присутствует в значительных количествах у мутантов hns . Биохимия. 2001; 83: 243–249.pmid: 11278075
  11. 11. Боннефой Э, Такахаши М, Янив Ю.Р. Параметры связывания ДНК белка HU Escherichia coli с крестообразной ДНК. J Mol Biol. 1994; 242: 116–129. pmid: 8089835
  12. 12. Castaing B, Zelwer C, Laval J, Boiteux S. Белок HU Escherichia coli специфически связывается с ДНК, которая содержит одноцепочечные разрывы или разрывы. J Biol Chem. 1995; 270: 10291–10296. pmid: 7730334
  13. 13. Lavoie BD, Shaw GS, Millner A, Chaconas G.Анатомия комплекса флексер – ДНК внутри промежуточного соединения транспозиции более высокого порядка. Клетка. 1996; 85: 761–771. pmid: 8646783
  14. 14. Альмирон М.А., Линк Дж., Ферлонг Д., Колтер Р. Новый ДНК-связывающий белок с регуляторными и защитными функциями в голодной Escherichia coli . Genes Dev. 1992; 6: 2646–2654. pmid: 1340475
  15. 15. Ceci P, Cellai S, Falvo E, Rivetti C, Rossi GL, Chiancone E. Конденсация ДНК и самоагрегация Escherichia coli Dps - это связанные явления, связанные со свойствами N-конца.Nucl Acids Res. 2004. 32: 5935–5944. pmid: 15534364
  16. 16. Грант Р.А., Фильм Диджей, Финкель С.Е., Колтер Р., Хогл Дж. М.. Кристаллическая структура Dps, гомолога ферритина, который связывает и защищает ДНК. Nat Struct Biol. 1998. 5: 294–303. pmid: 9546221
  17. 17. Де лос Риос С., Перона Дж. Дж. Структура Escherichia coli Лейцин-чувствительный регуляторный белок Lrp обнаруживает новую октамерную сборку. J Mol Biol. 2007; 366: 1589–1602. pmid: 17223133
  18. 18.Сеси П., Илари А., Фалво Е., Джангиакомо Л., Чианконе Е. Повторная оценка стабильности белка, связывания ДНК и защиты Mycobacterium smegmatis Dps. J Biol Chem. 2005; 280: 34776–34785. pmid: 16030020
  19. 19. Рой С., Сарасвати Р., Чаттерджи Д., Виджаян М. Структурные исследования второго Mycobacterium smegmatis Dps: неизменные и изменчивые особенности структуры, сборки и функции. J Mol Biol. 2008; 375: 948–959. Доступно: http: //www.ncbi.nlm.nih.gov/pubmed/17543333. pmid: 18061613
  20. 20. Юань Х.С., Финкель С.Е., Фенг Я.А., Качор-Гжесковяк М., Джонсон Р.С., Дикерсон Р.Э. Молекулярная структура белка FIS дикого типа и мутантного белка FIS: взаимосвязь между мутационными изменениями и функцией рекомбинационного энхансера или связыванием ДНК. Proc Natl Acad Sci USA. 1991; 88: 9558–9562. pmid: 1946369
  21. 21. Кавамура Т., Вартанян А.С., Чжоу Х., Далквист Ф.В. Дизайн участвует в регуляции PapI и Lrp оперона pap.J Mol Biol. 2011; 409: 311–332. pmid: 21338611
  22. 22. Cordeiro TN, Schmidt H, Madrid C, Juarez A, Bernado P, Griesinger C. et al. Непрямое считывание ДНК белком, родственным H-NS: структура комплекса ДНК С-концевого домена Ler. Путь PLoS. 2011; 7: e1002380.
  23. 23. Райс ПА, Ян С.В., Мидзуучи К., Нэш Х.А. Кристаллическая структура комплекса ИГФ-ДНК: разворот ДНК, индуцированный белком. Клетка. 1996. 87: 1295–1306. pmid: 8980235
  24. 24. Стелла S, Cascio D, Johnson RC.Форма малой бороздки ДНК управляет связыванием ДНК-изгибающего белка Fis. Gen Dev. 2010; 24: 814–826.
  25. 25. Сеси П., Илари А., Фалво Е., Чианконе Е. Белок Dps Agrobacterium tumefaciens не связывается с ДНК, но защищает ее от окислительного расщепления: кристаллическая структура рентгеновского излучения, связывание железа и свойства улавливания гидроксильных радикалов. J Biol Chem. 2003; 278: 20319–20326. pmid: 12660233
  26. 26. Стиллман Т.Дж., Упадхьяй М., Норте В.А., Седельникова С.Е., Каррадус М., Цоков С.и другие. Кристаллические структуры белков Dps Lactococcus lactis MG1363 показывают присутствие N-концевой спирали, которая необходима для связывания ДНК. Mol Microbiol. 2005; 57: 1101–1112. pmid: 160
  27. 27. Чианконе Э., Сеси П. Многогранная способность белков Dps бороться с бактериальными стрессовыми состояниями: детоксикация железа и перекиси водорода и связывание ДНК. Biochim Biophys Acta. 2010; 1800: 798–805. pmid: 20138126
  28. 28. Ceci P, Mangiarotti L, Rivetti C, Chiancone E.Активирующий нейтрофилы белок Dps Helicobacter pylori , HP-NAP, использует механизм, отличный от Escherichia coli Dps, для связывания и конденсации ДНК. Nucl Acids Res. 2007. 35: 2247–2256. pmid: 17371778
  29. 29. Гупта С., Чаттерджи Д. Бимодальная защита ДНК с помощью ДНК-связывающего белка Mycobacterium smegmatis из клеток стационарной фазы. J Biol Chem. 2003. 278: 5235–5241. pmid: 12466274
  30. 30. Вольф С.Г., Френкиль Д., Арад Т., Финкель С.Е., Кольтер Р., Мински А.Защита ДНК путем биокристаллизации, вызванной стрессом. Природа. 1999; 400: 83–85. pmid: 10403254
  31. 31. Frenkiel-Krispin D, Levin-Zaidman S, Shimoni E, Wolf SG, Wachtel EJ, Arad T. et al. Регулируемые фазовые переходы бактериального хроматина: неферментативный путь для общей защиты ДНК. EMBO J. 2001; 20: 1184–1191. pmid: 11230141
  32. 32. Френкиль-Криспин Д., Бен-Аврахам И., Энгландер Дж., Шимони Э., Вольф С. Г., Мински А. Реструктуризация нуклеоидов у бактерий в стационарном состоянии.Mol Microbiol. 2004. 51: 395–405. pmid: 14756781
  33. 33. Азам Т.А., Хирага С., Исихама А. Два типа локализации ДНК-связывающих белков в нуклеоиде Escherichia coli . Гены Клетки. 2000. 5: 613–626. pmid: 10947847
  34. 34. Френкиль-Криспин Д., Мински А. Нуклеоидная организация и поддержание целостности ДНК в E . coli , B . subtilis и D . радиодуранс .J. Struct Biol. 2006; 156: 311–319. pmid: 16935006
  35. 35. Huergo LF, Rahman H, Ibrahimovic A, Day CJ, Korolika V. Campylobacter jejuni Белок Dps связывает ДНК в присутствии железа или перекиси водорода. J Bacteriol. 2013; 195: 1970–1978. pmid: 23435977
  36. 36. Зет К. Биоминерализующие белки Dps: многофункциональные архитекторы природы. Биохим Дж. 2012; 445: 297–311. pmid: 22788214
  37. 37. Salgado H, Peralta-Gil M, Gama-Castro S, Santos-Zavaleta A, Muñiz-Rascado L, García-Sotelo JS.и другие. RegulonDB v8.0: наборы данных omics, эволюционное сохранение, нормативные фразы, перекрестно проверенные золотые стандарты и многое другое. Nucl Acids Res. 2013; 41 (выпуск базы данных): D203–213. pmid: 23203884
  38. 38. Calhoun LN, Kim JN, Ren Y, Song JJ, Kwon YM. ДНК-связывающий белок Dps функционирует как глобальный регулятор при голодании Salmonella enterica сероварном энтеридите во время голодания. Int J Microb Res. 2011; 3: 136–147. http://dx.doi.org/10.9735/0975-5276.3.3.136-147.
  39. 39.Пуртов Ю.А., Глазунова О.А., Антипов С.С., Покусаева В.О., Фесенко Е.Е., Преображенская Е.В. и другие. Промоторные острова как платформа для взаимодействия с нуклеоидными белками и факторами транскрипции. J Bioinform Comput Biol. 2014; 12: 1441006. pmid: 24712533 ​​
  40. 40. Ilari A, Ceci P, Ferrari D, Rossi GL, Chiancone E. Включение железа в Escherichia coli Dps дает ферритиноподобное микрокристаллическое ядро. J Biol Chem. 2002; 277: 37619–37623. pmid: 12163499
  41. 41.Ивахори К., Эномото Т., Фурушо Х., Миура А., Нишио К., Мисима Ю. и др. Синтез наночастиц сульфида кадмия в белке Dps из Listeria innocua . Chem Mater. 2007. 19: 3105–3111.
  42. 42. Игараси К., Исихама А. Двудольная функциональная карта E . coli альфа-субъединица РНК-полимеразы: участие С-концевой области в активации транскрипции с помощью цАМФ-CRP. Клетка. 1991; 65: 1015–1022. pmid: 1646077
  43. 43. Тутукина М.Н., Шавкунов К.С., Масулис И.С., Озолин О.Н.Антисмысловая транскрипция в локусе hns Escherichia coli . Мол Биол (Моск). 2010. 44: 439–447. pmid: 20608167
  44. 44. Маниатис Т., Фриш Э. Ф., Сэмбрук Дж. Молекулярное клонирование: лабораторное руководство. Колд-Спринг-Харбор, Нью-Йорк: Лаборатория Колд-Спринг-Харбор. Нажмите; 1982.
  45. 45. Рогулин Е.А., Перевязова Т.А., Железная Л.А., Матвиенко Н.И. Плазмида pRARE как вектор для клонирования с целью конструирования суперпродуцента сайт-специфической никазы N.BspD6I.Биохимия (Москва). 2004. 69: 1123–1127. pmid: 15527412
  46. 46. Антипов С.С., Покусаева В.О., Мелехов В.В., Озолин О.Н. Зависимость образования нуклеопротеидных комплексов с белком Dps от физико-химических свойств ДНК. Вопросы биологической медицинской и фармацевтической химии. 2013; 7: 24–28. Доступно: http://www.radiotec.ru/catalog.php?cat=jr19&art=13161
  47. 47. Altuvia S, Almiron M, Huisman G, Kolter R, Storz G. Промотор dps активируется OxyR во время роста и IHF и σ S в стационарной фазе.Mol Microbiol. 1994; 13: 265–272. pmid: 7984106
  48. 48. Lacour S, Landini P. Экспрессия SigmaS-зависимых генов в начале стационарной фазы в Escherichia coli : функция sigmaS-зависимых генов и идентификация их промоторных последовательностей. J Bacteriol. 2004; 186: 7186–7195. pmid: 15489429
  49. 49. Швырева У.С., Тутукина М.Н., Озолин О.Н. Бактериоферритин: свойства, структурная и функциональная организация регуляторной области гена dps .Биофизика. 2011; 56: 795–802.
  50. 50. Мачулин А.В., Дерюшева В.И., Юнусова А.К., Железная Л.А., Сердюк И.Н. Исследование сайт-специфического связывания ДНК с никелирующей эндонуклеазой Nt.BspD6I на уровне отдельной молекулы с помощью атомно-силовой микроскопии. Биофизика. 2012; 57: 314–317.
  51. 51. Мартинес А., Колтер Р. Защита ДНК во время окислительного стресса с помощью неспецифического ДНК-связывающего белка Dps. J Bacteriol. 1997; 179: 5188–5194. Доступно: http://jb.asm.org/content/179/16/5188.full.pdf + html. pmid: 9260963
  52. 52. Guex N, Peitsch MC. SWISS-MODEL и Swiss-PdbViewer: среда для сравнительного моделирования белков. Электрофорез. 1997; 18: 2714–2723. pmid: 9504803
  53. 53. Инглстон С.М., Дикман М.Дж., Грасби Д.А., Хорнби Д.П., Шарплс Г.Дж., Ллойд Р.Г. Связывание узлов Холлидея и процессинг белком RuvA Mycoplasma pneumoniae . Eur J Biochem. 2002; 269: 1525–1533. Доступно: http://www.ncbi.nlm.nih.gov/pubmed/11874468.pmid: 11874468
  54. 54. Хомякова Е.Б., Петрова М.В., Минят Э.Е., Иванов В.И. Структура ДНК со скользящей петлей: конкретная нуклеотидная последовательность образует только один уникальный конформер. Письма FEBS. 1998. 422: 265–268. Доступно: http://www.ncbi.nlm.nih.gov/pubmed/94. pmid: 94
  55. 55. Гхатак П., Кармакар К., Касетти С., Чаттерджи Д. Раскрытие роли Dps в организации микобактериальных нуклеоидов. PLoS ONE. 2011; 6: e16019. pmid: 21283627

способов взаимодействия Escherichia coli Dps с ДНК по данным атомно-силовой микроскопии

PLoS One.2015; 10 (5): e0126504.

, 1 , 2 , 3 , 4 , 1 , 3 , 5 , 5 , 5 , # 1 , 3 , * и # 1 , 3 , 5

Мелехов Владислав Васильевич

1 Отделение клеточной биологии Пущинского государственного естествознания, Пущино, Московская область, Российская Федерация,

2 Лаборатория новых методов в биологии Института биологического приборостроения РАН, Пущино, Московская область, Российская Федерация,

Ульяна С.Швырева

3 Отделение функциональной геномики и клеточного стресса, Институт биофизики клетки РАН, Пущино, Московская область, Российская Федерация,

Тимченко Александр Андреевич

4 Отделение физики нуклеопротеидов Института белковых исследований РАН, Пущино, Московская область, Российская Федерация,

Тутукина Мария Николаевна

1 Отделение клеточной биологии Пущинского государственного естествознания, Пущино, Московская область, Российская Федерация,

3 Отделение функциональной геномики и клеточного стресса, Институт биофизики клетки РАН, Пущино, Московская область, Российская Федерация,

Елена В.Преображенская

5 Кафедра биофизики и биотехнологии, Воронежский государственный университет, Воронеж, Российская Федерация,

Буркова Диана Владимировна

5 Кафедра биофизики и биотехнологии, Воронежский государственный университет, Воронеж, Российская Федерация,

Артюхов Валерий Григорьевич

5 Кафедра биофизики и биотехнологии, Воронежский государственный университет, Воронеж, Российская Федерация,

Ольга Н.Озолин

1 Отделение клеточной биологии Пущинского государственного естествознания, Пущино, Московская область, Российская Федерация,

3 Отделение функциональной геномики и клеточного стресса, Институт биофизики клетки РАН, Пущино, Московская область, Российская Федерация,

Антипов Сергей Сергеевич

1 Отделение клеточной биологии Пущинского государственного естествознания, Пущино, Московская область, Российская Федерация,

3 Отделение функциональной геномики и клеточного стресса, Институт биофизики клетки РАН, Пущино, Московская область, Российская Федерация,

5 Кафедра биофизики и биотехнологии, Воронежский государственный университет, Воронеж, Российская Федерация,

Дипанкар Чаттерджи, научный редактор

1 Отделение клеточной биологии Пущинского государственного естествознания, Пущино, Московская область, Российская Федерация,

2 Лаборатория новых методов в биологии Института биологического приборостроения РАН, Пущино, Московская область, Российская Федерация,

3 Отделение функциональной геномики и клеточного стресса, Институт биофизики клетки РАН, Пущино, Московская область, Российская Федерация,

4 Отделение физики нуклеопротеидов Института белковых исследований РАН, Пущино, Московская область, Российская Федерация,

5 Кафедра биофизики и биотехнологии, Воронежский государственный университет, Воронеж, Российская Федерация,

Индийский институт науки, ИНДИЯ,

# Внесено поровну.

Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует.

Задумал и спроектировал эксперименты: ONO SSA AAT. Проведены эксперименты: VVM USS MNT EVP DVB SSA. Проанализированы данные: ONO SSA AAT VGA. Предоставленные реагенты / материалы / инструменты анализа: ONO SSA VGA. Написал статью: ONO SSA.

Поступило 17.11.2014; Принято 2 апреля 2015 г.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии надлежащего указания автора и источника.

Эта статья цитируется в других статьях в PMC.

Abstract

Многофункциональный белок Dps играет важную роль в ассимиляции железа и решающую роль в упаковке бактериального генома. Его мономеры образуют додекамерные сферические частицы, накапливающие ~ 400 молекул окисленных ионов железа внутри белковой полости и применяющие гибкие N-концевые концы каждой субъединицы для взаимодействия с ДНК. Осаждение железа - это хорошо изученный процесс, с помощью которого клетки удаляют токсичные ионы Fe 2+ из генетического материала и сохраняют их в легкодоступной форме.Однако способ взаимодействия с линейной ДНК оставался загадкой, а бинарные комплексы с Dps до сих пор не охарактеризованы. Широко распространено мнение, что Dps связывает ДНК без какой-либо последовательности или структурных предпочтений, но несколько линий доказательств продемонстрировали его способность дифференцировать экспрессию генов, которая предполагает определенную специфичность. Здесь мы показываем, что Dps имеет различное сродство к двум фрагментам ДНК, взятым из регуляторной области гена dps . С помощью атомно-силовой микроскопии мы обнаружили, что Dps преимущественно занимает термодинамически нестабильные концы линейных двухцепочечных фрагментов ДНК и имеет высокое сродство к центральной части разветвленной молекулы ДНК, самоорганизующейся из трех одноцепочечных олигонуклеотидов.Было высказано предположение, что Dps предпочитает связывание с теми областями в ДНК, которые обеспечивают больше контактных площадок для триады его ДНК-связывающего пучка, связанного с одной вершиной белковой глобулы. Насколько нам известно, это первое исследование, в котором был обнаружен нуклеоидный белок со сродством к разветвленной ДНК, типичным для участков генома с прямыми и инвертированными повторами. Поскольку такие структурные элементы являются повсеместной особенностью бактериальных и эукариотических геномов, они требуют особого внимания, но белковая система, эволюционно адаптированная для этой функции, еще не известна, и мы предлагаем Dps в качестве предполагаемого компонента этой системы.

Введение

Все живые организмы используют определенные структурные белки, чтобы поддерживать свои геномы в функциональном состоянии и защищать их от повреждений различными физическими, химическими факторами и факторами окружающей среды. У эукариот основная ответственность за реализацию функциональности в безопасных условиях лежит на пяти положительно заряженных гистоновых белках, которые конденсируют или расслабляют определенные геномные локусы, взаимодействуя с ДНК без специфичности последовательности. У прокариот эту функцию выполняют 10–12 очень распространенных белков [1–3], которые взаимодействуют с ДНК, распознавая структурные особенности двойной спирали или даже связываясь со специфическими мотивами последовательностей в бактериальной хромосоме.

Всего около 170 000 молекул различных белков заботятся о структуре E . coli при экспоненциальном росте, а переход в стационарный режим сопровождается увеличением их количества до ~ 290 000 [1]. В быстрорастущих клетках наиболее распространенным нуклеоидным белком является Fis ( F Actor of и nversion s timulation), количество которых достигает 60 000 молекул на клетку. В голодных клетках внутриклеточный уровень Fis падает, в то время как доминирующим белком становится Dps ( D NA-связывающий белок p из клеток s tarved, 180 000 молекул на клетку) [1].Fis и по крайней мере четыре других структурирующих белка (IHF, Lrp, H-NS и его паралог StpA) распознают сайты, для которых может быть выведен консенсусный мотив [1, 4-7]. Два других нуклеоидных белка (CbpA и CbpB), а также H-NS и StpA связывают изогнутую ДНК [8–10]; в то время как HU ( H съедает стабильный белок и ) может образовывать комплексы с широким спектром различных геномных локусов, включая изогнутую, неупорядоченную, разорванную или крестообразную ДНК [11–13]. Информация о взаимодействии Dps с ДНК менее достоверна.Считается, что он образует только неспецифические комплексы с отрицательно заряженным сахарно-фосфатным остовом [1, 14–16].

Большинство архитектурных белков бактериального нуклеоида действуют как гомо- или гетеродимеры (Fis, HU, CbpA, IHF, H-NS и StpA). DnaA и CbpB (Rob) действуют как мономеры, в то время как Lrp и Dps могут образовывать большие олигомерные частицы. В этой паре Lrp ( L , реагирующий на эвцин, r egulatory p rotein) существует как смесь димеров, октамеров и гексадекамеров, равновесие которых зависит от присутствия лейцина, благоприятствующего конфигурации октамера.Сегмент ДНК, содержащий сайт связывания Lrp, оборачивается вокруг этого октамера, образуя структуру, подобную нуклеосоме [17]. Доминирующей олигомерной формой Dps является додекамер, который собирается из димеров [18] или тримеров [19]. Додекамеры прочно связываются с ДНК, но способность более мелких олигомеров образовывать аналогичные комплексы еще не была хорошо документирована.

Два белка, которые взаимодействуют со специфическими последовательностями в ДНК (Fis и Lrp), имеют классические ДНК-связывающие домены спираль-поворот-спираль [20, 21]; в то время как большинство нуклеоидных белков полагаются на «косвенное считывание», т.е.е. используют разные структурные модули для распознавания их сайтов связывания в зависимости от конформационных особенностей, опосредованных последовательностью [22–24]. В Dps E . coli эта функция в первую очередь приписывается гибким N-концевым хвостам [16], содержащим три остатка лизина в положениях 5, 8 и 10 и остаток аргинина в положении 18. Делеция первых 8 или 18 аминокислот резко снизилась. способность Dps связывать ДНК и агрегировать с другими молекулами Dps [15], но рентгеноструктурный анализ не выявил типичных ДНК-связывающих модулей на N-концевых концах или каких-либо других сегментах на поверхности белка [16].Таким образом поражает близость E . coli Dps к ДНК в настоящее время понимается как сильное электростатическое взаимодействие между положительно заряженными боковыми цепями гибких белковых модулей и отрицательно заряженным остовом ДНК.

Отсутствие N-концов (как у MsDps1 из Mycobacterium smegmatis [18, 19]) или их пониженная гибкость (как у MsDps1 из M . smegmatis [18], Dps Agrobacterium tumefaciens [18]). 25] и молекулы DpsA / DpsB Lactococcus lactis [26]) изменили способ взаимодействия или снизили способность связывания / конденсации ДНК [27].Таким образом, в Dps A . tumefaciens N-концов иммобилизуются на поверхности додекамеров сеткой водородных связей и солевых мостиков, вызывая ингибирование их способности связывать ДНК [25]. В обоих L . lactis Dps белки на N-концах образуют короткие α-спирали [26], выступающие на поверхности белка, и связывают соседние субъединицы через солевые мостики и водородные связи. Эти α-спирали стабилизируют додекамерную структуру белка, а также участвуют во взаимодействии с ДНК, поскольку удаление первых 20 аминокислот из DpsA нарушает способность связывания ДНК.Но замена трех Lys в положениях 9, 15 и 16 на Glu не повлияла на взаимодействие с ДНК [26], вероятно, потому, что эти остатки в структуре α-спиралей «либо обращены, либо расположены параллельно» поверхности додекамера [ 26]. Dps-гомолог Helicobacter pylori (HP-NAP) не содержит положительно заряженного N-конца, но вместо этого имеет положительно заряженную поверхность белка, которая напрямую взаимодействует с молекулами ДНК [28]. Таким образом, способ связывания Dps-ДНК может отличаться для молекул Dps от разных бактерий, но электростатические взаимодействия, скорее всего, играют решающую роль в этих процессах.

Существует четыре теоретических модели, описывающих E . coli Взаимодействие Dps-ДНК на субмолекулярном уровне. Они основаны на данных, полученных с помощью электронной [14, 26, 29–32] или атомно-силовой [15, 18, 28] микроскопии с ограниченным разрешением. Первый был предложен Almiron et al. [14] для объяснения электронных микрофотографий E . coli Dps: комплексы ДНК, наблюдаемые как высокоупорядоченные двумерные сотовые массивы [14, 29].Модель предполагает образование двух связанных гексамерных колец мономеров Dps вокруг двойной спирали ДНК. Однако ДНК-индуцированная конформационная перестройка сферических додекамерных частиц или сборка гексамерных колец из димеров или тримеров еще не зарегистрированы. Вторая модель основана на наблюдении крупных сокристаллов Dps-ДНК [30, 31]. Это предполагает способность Dps образовывать стопку чередующихся слоев, внутри которых ДНК изолирована в полостях между соседними додекамерами.Такие сокристаллы были обнаружены в голодных клетках, содержащих огромное количество Dps [30], и имеют решающее значение для защиты ДНК от множества повреждающих агентов. Однако в экспоненциально растущих клетках Dps был обнаружен как белок, равномерно распределенный по всему нуклеоиду [33].

Третья модель учитывала тот факт, что при физиологических значениях pH как внешняя, так и внутренняя поверхности глобулы Dps заряжены отрицательно (IP = 6,01). Итак, белок должен отталкивать, а не привлекать ДНК. Поскольку присутствие ЭДТА ингибирует связывание ДНК, было высказано предположение, что это взаимодействие опосредуется мостиками, образованными ионами металлов между отрицательно заряженной поверхностью белка и скелетом ДНК [30–32, 34, 35].Хотя эта модель не учитывает функциональность положительно заряженных N-концов, ее, вероятно, можно рассматривать как наиболее универсальную, поскольку несколько линий доказательств указывают на зависимость образования комплекса Dps-ДНК от Mg 2+ [30–32, 34] или Fe 2+ [35]. Наконец, модель, предложенная К. Зетом [36], подчеркивает способность Dps к неспецифическому связыванию ДНК и предполагает, что ДНК навивается вокруг округлой додекамерной частицы гистоноподобным образом.

Нуклеоидные белки с последовательностью или структурной специфичностью участвуют в дифференциальной регуляции генов [37].Такая информация для Dps в основном отсутствует. Тем не менее, было задокументировано, что dps -нулевой мутант E . coli имел значительные изменения в профиле белка [14], и микроматричный анализ был проведен для мутанта dps -null S . enteritidis [38] выявил сотни генов с dps -зависимой транскрипцией. Мы также обнаружили, что делеция dps влияет на транскрипцию определенных генов, оставляя экспрессию других геномных локусов E . coli без изменений [39]. Все эти факты предполагают некоторую специфичность связывания Dps-ДНК, и здесь мы попытались пролить свет на эту проблему с помощью трех разных подходов, используя фрагменты ДНК разной длины, последовательности и структурной организации. Наша цель была подкреплена тем фактом, что Dps - уникальный белок в семействе структурирующих факторов, обеспечивающих не только физическую, но и химическую защиту от повреждающих агентов. Высококонсервативный ферроксидазный центр Dps обеспечивает секвестрацию токсичных ионов Fe 2+ , что позволяет избежать образования гидроксильных радикалов с помощью химии Фентона [40].Окисленные ионы железа затем накапливаются внутри белковой полости и могут высвобождаться при восстановлении. Эта полость может вместить более 400 оксидов железа и может содержать оксиды других металлов, которые изменяют ферромагнитные свойства минерализованного ядра. Итак, сейчас Dps рассматривается как весьма перспективная биомолекула для наноэлектроники, дающая возможность создавать наноустройства с калиброванными ферромагнитными частицами [41]. Некоторая специфичность в его способе взаимодействия с ДНК может быть очень благоприятной при разработке новых материалов с предсказуемым расположением этих частиц.

Материалы и методы

Очистка Dps

The E . Ген coli dps амплифицировали с праймерами TAATTTCTAGAACATAACATCAAGAGG и AGCTCTAGATTTATTCGATGTTAG и клонировали в вектор экспрессии pGEMΔXba [42] с использованием сайта Xba I. Нуклеотидную последовательность рекомбинантного гена, которая не была модифицирована какой-либо меткой, проверяли прямым секвенированием. Экспрессия гена осуществлялась в E . coli BL21 (DE3) клетки, выращенные в среде LB в присутствии ампициллина (100 мкг / мл) при 37 ° C.Транскрипцию рекомбинантного гена индуцировали 0,02 мМ IPTG при OD600 0,4–0,6, и накопление белка позволяли в течение 12 часов. Его очищали с помощью ионообменной хроматографии (DEAE-Sephadex A-25, GE Healthcare, Швеция) и гель-фильтрации на Sephadex G-200 (Pharmacia, Швеция). Белок концентрировали на колонках Vivaspin 20 (Sartorius, Германия), диализовали против буфера для хранения, содержащего 50 мМ трис-HCl (pH 8,0), 50 мМ NaCl, 0,1 мМ EDTA, 5% глицерина, и хранили в морозильной камере.Конечная чистота нативного белка была выше 95%.

Получение фрагментов ДНК

Фрагменты линейной ДНК получали с помощью ПЦР с использованием геномной ДНК E . coli K12 MG1655 и праймеры (Евроген, Россия), перечисленные в. После ПЦР эти фрагменты ДНК очищали от субстратов и праймеров с помощью 5% -ного ПААГ-электрофореза, экстрагировали и растворяли в воде milliQ. Концентрацию фрагментов ДНК определяли на спектрофотометре ND-1000 (NanoDrop Technologies Inc., СОЕДИНЕННЫЕ ШТАТЫ АМЕРИКИ).

Таблица 1

Праймеры и олигонуклеотиды.

Последовательность
Грунтовки
dps_F1 5’-GGAAGATCTCCTCGGAGAAACACT-3 ’
dps_R1 5’-ATATCTAGATATATAAAGACGGTGTA-3 ’
dps_F2 5’-ATGCAGATCTTCTCGCTACTTTTC-3 ’
dps_R2 5’-TCCTCTAGATGTTATGTCCCAGT-3 ’
Олиго
Y1 5'-AAAAAAAAAAAAAAAAAAAAAAAAAACCCCCCCCCCCCCCCCCCCCCCCCCCCC-3 '
Y2 5'-CiscoCCCCCCCCCCCCCCCCCCCCCCCCTTTTTTTTTTTTTTTTTTTTTTTTT-3 '
Y3 5'-GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG-3 '
Y5 5’-CTTTTCCTCTACACCGTCTTTATATATCGAATTAAGAAGTCGCAATGAGTATTACTTTGTAAAT-3 ’
Y6 5’-CAAGGGTAAACGAACCTTGCGCTTTCTTAAATATTCGATATATAAAGACGGTGTAGAGGAAAAG-3 ’
Y7 5’-ATTTACAAAGTAATACTCATTGCGACTTCTTAATTTAAGAAAGCGCAAGGTTCGTTTACCCTTG-3 ’
Y8 5’-ATTTACAAAGTAATACTCATTGCGACTTCTTAATTTAAGAAAGCGCAAGGAACGTTTACCCTTG-3 ’
Y9 5’-GCATAACCATGCAGAATTTCTCGCTACTTTTCCTCTACACCGTCTTTATATATCGAATTAAGAAGTCGCAATGAGT ATTACTTTGTAAAT-3 ’
Y10 5'-CAAGGGTAAACGAACCTTGCGCTTTCTTAAATATTCGATATATAAAGACGGTGTAGAGGAAAAGTAGCGAGAAATT CTGCATGGTTATGC-3 '

разветвленных двухцепочечных молекул, каждый из которых был образован наполовину из двух или трех однонитевых олигонуклеотидов. два других фрагмента ().Олигонуклеотиды растворяли в 5 мМ растворе MgCl 2 , плавили отдельно при 97 ° C в течение 5 минут, смешивали и дополнительно инкубировали при 97 ° C в течение 5 минут. Затем смесь переносили на водяную баню с температурой 70 ° C на 10 минут и давали постепенно остыть до комнатной температуры (4–5 часов).

Анализы сдвига электрофоретической подвижности

Комплексы

ДНК-Dps получали смешиванием фрагментов ДНК с Dps в различных молярных соотношениях в 10 мкл буфера, который содержал 50 мМ трис-HCl (pH 7,5), 0.1 мМ ЭДТА и 50 мМ NaCl. Образованию комплекса давали возможность в течение 30 минут при 37 ° C. Эффективность связывания оценивали с помощью анализа сдвига геля, как описано в [43]. Электрофоретическое фракционирование проводили в 5% ПААГ в буфере ТВЭ (89 мМ Трис-HCl, 89 мМ Борная кислота, 2 мМ ЭДТА, pH 8,0) при 200–250 В и 70–110 мА. Полосы ДНК окрашивали бромидом этидия или AgNO 3 .

футпринтинг ДНКазы I

5’-концы праймеров dps _F1 и dps _R2 () были мечены 32 P с использованием полинуклеотидкиназы Т4 (Thermo Scientific, Литва) и протокола производителя.ПЦР амплифицировали три фрагмента ДНК с парами праймеров 32 P- dps _F1— dp s_R1, dps _F1 - 32 P- dp s_R2 и dps _F2 - dps _R2. Амплифицированные фрагменты экстрагировали из геля, как описано в [44]. Перед образованием комплекса образцы ДНК (1 пмоль на реакцию) инкубировали в течение 10 минут при 37 ° C в 30 мкл буфера для транскрипции, содержащего 50 мМ трис-HCl (pH 8,0), 0,1 мМ EDTA, 0.1 мМ DTT, 10 мМ MgCl 2 , 50 мМ NaCl и 5 мг / мл БСА (Sigma, США). Затем добавляли белок Dps в 2–10-кратном молярном избытке и оставляли взаимодействие в течение 40 минут при 37 ° C. Затем образцы обрабатывали 1 мкг / мл ДНКазы I в течение 2 минут. Расщепление прекращали добавлением 35 мкл 8 М ацетата аммония. Продукты переваривания ДНКазой 1 осаждали этанолом, растворяли в формамидном буфере [44] и наносили на 6% денатурирующий полиакриламидный гель. Образцы фракционировали в буфере TBE и визуализировали с помощью радиоавтографии.Гели калибровали по лестнице G-секвенирования.

Подготовка образцов для атомно-силовой микроскопии (АСМ)

Накопленные растворы очищенных Dps пропускали через колонку с сефадексом G-15 (1x5 см 3 ) для удаления любых агрегированных частиц. Собранные фракции разбавляли в буфере, содержащем 50 мМ Трис-HCl (pH 7,5) и 10 мМ NaCl, до конечной концентрации 1 нг / мкл (4,4 нМ додекамеров) и 2 мкл этого раствора наносили на слюду для сканирования. Линейные фрагменты ДНК или Y-образные структуры растворяли в 5 мМ MgCl 2 до концентрации 1 нг / мкл (4-19 нМ).Комплексы Dps с различными фрагментами ДНК формировали при комнатной температуре в буфере: 50 мМ Трис-HCl (pH 7,5), 10 мМ NaCl и 5 мМ MgCl 2 (10 мкл) в течение 30 минут и наносили на слюду. Для образования комплекса использовали трех-десяти молярный избыток линейных фрагментов ДНК или пятидесяти молярный избыток разветвленных молекул. Аналогичным образом готовили контрольные образцы, но без Dps. Все образцы выдерживали на слюде в течение 5 минут, дважды промывали водой в течение 30 секунд, сушили и структуру образовавшихся комплексов анализировали на АСМ Интегра-Вита (НТ-МДТ, Россия) с использованием кантилеверов NSG03 с радиусом кривизны кончика 10 нм и Резонансная частота 47–150 кГц.Измерения проводились в полуконтактном (постукивающем) режиме. Полученные изображения анализировали с помощью программы Nova (NT-MDT, Россия).

Получение разорванной ДНК

Для наблюдения комплексов Dps с ДНК, содержащей одноцепочечные разрывы, 10 мкг плазмиды pET28b обрабатывали никазой Nt.BspD6I [45]. Реакционная смесь (20 мкл) содержала 10 мМ трис-HCl, pH 7,5, 10 мМ MgCl 2 , 150 мМ KCl, 1 мМ DTT и 10 единиц никазы или равный объем буфера для хранения Nt.BspD6I (10 мМ Tris- HCl, pH 7.5, 50 мМ KCl, 0,1 мМ EDTA, 1 мМ DTT, 50% глицерин) для экспериментального или контрольного образца соответственно. Переваривание было разрешено в течение 1 часа при 55 ° C. Плазмидную ДНК немедленно собирали экстракцией фенол-хлороформ, осаждали этанолом и растворяли в воде. Кривые плавления были получены для обеих плазмид, что подтвердило образование трещин. Комплексы с Dps в молярном соотношении Dps: ДНК 5: 1 или 10: 1 получали, как описано выше.

Результаты

Dps имеет разное сродство к двум фрагментам промоторной области

dps

Уже известно, что делеция dps изменила профиль белков в голодном E . coli [14] и изменил профиль транскрипции в S . enteritidis [38] и E . coli [39]. Но этот очевидный регуляторный эффект может быть опосредован взаимодействием с регуляторными белками, занимающими их сайты связывания, которые высвобождаются в мутанте dps -null. Другими словами, данные, полученные in vivo , наводят на размышления, но их недостаточно для отказа от традиционной точки зрения, согласно которой Dps взаимодействует с ДНК без какой-либо специфичности [1–3, 14–16].Мы также ранее обнаружили, что две A / T-богатые области, содержащие « промоторный остров » yeaI и промоторы dps , имеют более высокое сродство к Dps, чем два линейных фрагмента ДНК, представляющих кодирующие последовательности и межгенное пространство, расположенное между конвергентными генами [ 46]. Эти эксперименты были выполнены in vitro , в отсутствие какой-либо конкуренции с регуляторными белками, что увеличивало возможность селективного взаимодействия. Поскольку факторы транскрипции обычно влияют на экспрессию собственных генов, регуляторная область dps была выбрана как наиболее многообещающий кандидат для демонстрации «специфического» связывания.Таким образом, фрагмент 420 п.н., охватывающий регуляторную область гена dps и взаимодействующий с белком Dps, был разделен на две половины. Один (длиной 259 п.н.) был получен методом ПЦР с праймерами dps _F2 и dps _R2 () и включал основной промотор этого гена - P dps [47, 48]. Другой (длиной 214 п.н.) содержал дистальный промотороподобный сайт P3, который демонстрировал низкую транскрипционную активность, но был важен для максимальной экспрессии dps [49].

Поскольку ДНК-связывающая активность Dps обычно сопровождается самоагрегацией, а агрегированные комплексы не попадают в гель [1, 14, 19, 35, 39, 49], эффективность связывания оценивали на основе свободной ДНК. остался несвязанным. Используя смешанные анализы, содержащие обе половины регуляторной области в одном образце, мы обнаружили, что фрагмент с функциональным промотором имеет более высокое сродство к Dps, чем дистальная часть регуляторной области (). Таким образом, стало ясно, что, образуя комплексы со всеми протестированными фрагментами ДНК [39], Dps может с определенной селективностью связываться с промоторной областью собственного гена.Затем мы попытались локализовать сайт связывания Dps в этой области с помощью метода футпринтинга ДНКазы I. Но обнаружив множественные гиперреактивные сайты и наблюдая четко защищенные R1- и F2-концы (схема в) в обоих небольших фрагментах при большом молярном избытке Dps (10-кратный), при 5-кратном избытке мы обнаружили только несколько защищенных полос (~ 175 и ~ 113 п.н. ниже праймера dps _F1 и в области 120–151 п.н. выше праймера dps _R2). Последний воспроизводимо наблюдался в комплексах как с короткими (F2-R2), так и с длинными (F1-R2) фрагментами, предполагая некоторую специфичность в этом связывании.Вот почему на следующем этапе мы использовали атомно-силовую микроскопию (АСМ) для характеристики общей топологии комплексов Dps-ДНК.

[A]: Пример анализа сдвига электрофоретической подвижности, выполняемого, как описано в разделе «Материалы и методы».

Один пмоль фрагмента ДНК длиной 214 п.н., амплифицированного с праймерами dps _F1 и dps _R1 (обозначенный как F1-R1), загружали только на дорожку 1 в качестве независимого маркера. Другие образцы содержали два фрагмента (по 1 пмоль каждый) и Dps, как указано выше на фотографии.Гель калибровали по маркерной лестнице (M). [B] Анализы футпринтинга ДНКазы I, выполненные для комплексов Dps с фрагментами ДНК F1-R1, F2-R2 и F1-R2. 32 Р-меченых праймеров отмечены звездочками. Гели калибровали по продуктам лестницы G-секвенирования. Позиционные метки показывают расстояние до 32 P-меченных праймеров F1 или R2. Защищенные сайты отмечены пунктиром. Гиперреактивные сайты не помечаются. [C] : Схема, иллюстрирующая относительное расположение и структурную организацию проанализированных фрагментов.Прямые и инвертированные повторы в их последовательностях усилены и дополнительно обозначены стрелками. Соответствующие полосы в [B] обозначены открытыми и серыми стрелками для прямых и инвертированных повторов соответственно. Изогнутая стрелка указывает сайт начала транскрипции в промоторе P dps .

Взаимодействуя с линейными фрагментами ДНК Dps обычно связывает концы двухцепочечных молекул

демонстрирует изображения очищенного Dps с помощью АСМ. Большинство наблюдаемых частиц имели квазисферическую форму с высотой около 7 нм, что хорошо согласуется с ожидаемым размером [16].Расчетный вертикальный размер разнесенных молекул ДНК составил 2 нм ( ) , что также точно соответствует ожидаемому значению. Однако планарные размеры на АСМ-изображениях зависят от конечного размера острия кантилевера (в нашем случае R = 10 нм), а точность их измерения зависит от размера объекта. Таким образом, видимые диаметры белковых частиц в плоской проекции составляли 27–32 нм, кажущаяся ширина двойной спирали ДНК - ~ 21 нм, а длины ДНК-фрагментов 214, 259 и 420 п.н. составляли 76, 93 и 146 нм, т.е. .е. лишь немного больше ожидаемых значений (73, 88 и 143 нм соответственно). Таким образом, длину длинных молекул ДНК можно оценить достаточно точно.

изображений АСМ.

[A] : белок Dps; [BD] : ДНК-фрагменты, содержащие соответственно полную регуляторную область гена dps (420 п.н., праймеры dps_ F1 и dps_ R2), его проксимальный (259 п.н., праймеры dps_ F2 и dps_ ). R2) и дистальной (214 п.н., праймеры dps_ F1 и dps_ R1) части.Панели b и c : комплексы, образованные Dps с 214 п.н. (b) и 259 п.н. (c) ДНК-фрагментами. Белые шкалы представляют 100 нм.

Все образцы белка оказались довольно однородными, обычно содержащие менее 20% частиц меньшего размера, чем додекамеры. Удивительно, но они не были загрязнены фрагментами ДНК, плотное связывание которых составляло , а априорное ожидалось [14, 15], или агрегатами (). Однако образование комплекса с ДНК спровоцировало сильную агрегацию.Удаление агрегатов путем промывки образцов слюды позволило зарегистрировать индивидуальные комплексы Dps как с короткими фрагментами ДНК, так и с использованием анализа сдвига электрофоретической подвижности и отпечатков пальцев (). В обоих случаях мы наблюдали взаимодействие белковых частиц с концами молекул ДНК (). Мы не видели ни одного упорядоченного двумерного массива, зарегистрированного ранее с помощью электронной микроскопии [14, 29–32, 34, 36]. Но это было ожидаемо, поскольку такие комплексы никогда не наблюдались с помощью АСМ [15, 18, 28], и мы намеренно удалили агрегаты путем интенсивной промывки.Мы также не обнаружили гексамерных колец, охватывающих ДНК [14], или убедительных доказательств того, что нуклеосомоподобная ДНК обвивается вокруг сферических частиц Dps [36], которые ожидались в рамках существующих моделей. Но мы также не обнаружили большого количества молекул Dps, взаимодействующих с внутренними частями линейных фрагментов ДНК. Даже если такие комплексы могут быть специфически вымыты агрегированным белком, стало ясно, что Dps может связывать концы двухцепочечной ДНК. Поскольку фрагменты F1-R1 и F2-R2 перекрываются для 53 b.п. в их A / T-богатых концах R1 и F1, в то время как две другие области с высоким содержанием A / T соответствуют оставшимся двум областям контакта с Dps (), мы предположили, что более высокое сродство этого белка к фрагменту F2-R2 () тривиально объясняется его меньшей термодинамической стабильностью (65 и 58% для фрагментов F2-R2 и F1-R1 соответственно).

Y-образные разветвленные конструкции являются идеальными мишенями для Dps

Две конструкции использовали для оценки сродства Dps к A / T-богатой ДНК. Один из них был построен из 2 синтетических олигонуклеотидов Y1 (57 n) и Y3 (64 n) () как искусственная модель концов ДНК.Он имел стабильный G / C-ствол и две гибкие однонитевые ветви, одна из которых состояла из аденинов (). Если Dps имеет повышенное сродство к одноцепочечной ДНК, мы ожидали найти его в комплексе с этими одноцепочечными ветвями, в то время как G / C-стебель может выступать из образованных комплексов. Другая конструкция была построена из олигонуклеотидов Y1, Y2 и Y3 () и содержала три ветви. Две длинные ветви в этой молекуле имеют только пары оснований G / C, в то время как короткая содержит только пары A / T и может быть идеальной мишенью для концевого специфического взаимодействия ().В этом случае мы ожидали найти Dps в конце короткой ветви.

Комплексы, образованные ДПС с четырьмя искусственными разветвленными конструкциями, схематично тонут на каждом участке.

Последовательность цветных кружков соответствует последовательности используемых олигонуклеотидов (). Панели демонстрируют изображения АСМ, полученные для свободных образцов ДНК и их комплексов с Dps (левое и правое сканирование соответственно). Сборку конструкций ДНК и формирование комплекса выполняли, как описано в разделе «Материалы и методы».Вставка на правой панели Рис. D иллюстрирует трехмерное изображение комплексов, образованных триплексом Y5_Y6_Y8. Хорошо видны концы всех трех ветвей. Белые полосы представляют масштабы 100 нм.

На левой панели показаны примеры свободных молекул ДНК, собранных из праймеров Y1 и Y3. Все они выглядят как зерна, но не как молекулы Y-образной формы. Это может быть связано со способностью гуанинов к квазикомплементарному взаимодействию с аденинами и гуанинами. В результате видимый продольный размер большинства наблюдаемых частиц составляет около 25 нм, что меньше, чем ожидалось для полностью растянутого дуплекса (32 * 0.34 + 32 * 0,59 = 29,8 нм). Также возможно, что эти бинарные комплексы по своей сути гетерогенны, поскольку 3'-концевой C Y1 может связывать не только 5'-концевой G Y3, но также и любой другой гуанин в его поли G-последовательности, тем самым создавая смесь разные дуплексы. Однако все они должны содержать хотя бы небольшую часть одноцепочечной ДНК. Помимо зерен длиной 25 нм, мы также наблюдали более мелкие частицы с размером в диапазоне 13–20 нм, которые могут представлять собой одиночные олигонуклеотиды, образующие квадруплексы или другие вторичные структуры.

Добавление Dps изменило структуру этих частиц. Однако вместо обнаружения ожидаемых двухцепочечных спиралей, вытянутых из бинарных комплексов, мы наблюдали 2–4 неупорядоченных одноцепочечных хвоста ДНК (). Эти хвосты имели видимую длину ~ 14–60 нм. Если принять во внимание ожидаемые ошибки в плоских проекциях, их можно рассматривать как два олигонуклеотида с расчетной длиной 34 и 38 нм, прикрепленные своими концами или внутренними частями к N-концам (или поверхности) Dps, или как одноцепочечные ветви. двух Y-образных молекул, одновременно взаимодействующих с одним белком.В обоих случаях максимальная длина наблюдаемых одноцепочечных хвостов больше, чем одноцепочечных ветвей в правильно собранном дуплексе (15–20 нм), что указывает на то, что начальное связывание Dps с зерноподобными частицами было достаточно сильным, чтобы перестроить их структура и удерживать неупорядоченные молекулы.

Разветвленные молекулы ДНК были собраны из праймеров Y1, Y2 и Y3 (). Они сформировали конструкции, напоминающие Y-образную форму (левая панель), но состояли из асимметричного модуля V-образной формы и меньшего домена, связанного с основной частью.Размер этого ассоциата точно соответствовал мелким зернам внутри, а длина V-образного модуля варьировалась в диапазоне 24–30 нм (ожидаемый размер в самом длинном измерении составлял: 64 * 0,34 = 21,8 нм) и среднее соотношение между двумя сторонами было равно 0,88 (ожидаемое значение: 57/64 б.п. = 0,89). Таким образом, существует вероятность того, что самосборка наблюдаемых частиц происходила через образование комплементарного триплекса, связанного с дуплексом неканоническим спариванием оснований. Электрофоретическое фракционирование этих комплексов действительно выявило две полосы, соответствующие триплексу и дуплексу (, дорожка 1).Более короткая сторона V-образного модуля (), скорее всего, соответствовала ветви A / T, в то время как одна ветвь G / C была конформационно скрыта и могла контактировать с небольшим ассоциатом. Ориентация триплекса по отношению к этому ассоциату была случайной, предполагая, что они собираются независимо от олигонуклеотидов. Смесь собранных молекул также содержала 10–20% более крупных частиц Y-образной формы (длина: 53–62 нм, высота: в среднем 2,6 нм), вероятно, образованных из триплексов и дуплексов, уложенных стопкой из-за квазикомплементарного взаимодействия квадруплексного типа вдоль G-прядь.

Анализы сдвига электрофоретической подвижности, выполненные для комплексов Dps с Y-образными конструкциями Y1_Y2_Y3 (утопить) и Y5_Y6_Y7 (аналогично Y5_Y6_Y8, утопить, но без одноцепочечной петли).

Состав образцов и молярное соотношение Dps: ДНК указаны над фотографиями. Молекулы разветвленной ДНК собирали из указанных олигонуклеотидов, смешанных в равных концентрациях (2–5 пмоль каждый), и получали, как описано в разделе «Материалы и методы». Без предварительного фракционирования их использовали для образования комплекса с Dps.Количество Dps было выбрано исходя из предположения, что все олигонуклеотиды образуют триплекс, как в случае Y5_Y6_Y7. Следовательно, указанные молярные отношения для Y1_Y2_Y3 завышены. Гели калибровали с помощью маркерных фрагментов ДНК (M) и окрашивали AgNO 3 , чтобы визуализировать как молекулы ДНК, так и Dps.

Обе Y-образные структуры взаимодействовали с Dps, но белок в этом случае был обнаружен только в центральной части разветвленных искусственных конструкций (правая панель).В составных комплексах он не препятствует связыванию с концом A / T- или G / C ветви верхней молекулы. Но небольшие конструкции с кажущимся размером 24-30 нм также не обнаруживают концевого специфического связывания (вставки на правой панели). Поскольку размер этих конструкций был такой же, как кажущийся диаметр Dps в плоской проекции, они были почти полностью покрыты белком, хотя концы всех трех ветвей были видимыми и идентифицируемыми.

Чтобы сравнить сродство Dps к триплексу Y1_Y2_Y3 и соответствующим бинарным структурам, мы приготовили смесь их самоорганизованных молекул и, без фракционирования, подвергли ее взаимодействию с Dps (дорожки 1–3).Трехкратный молярный избыток белка был достаточен для связывания всех образованных триплексов, в то время как большинство дуплексов оставалось свободным. Основываясь на этих данных, мы предположили, что Dps может связывать одноцепочечную ДНК и даже плавить двойную спираль (), но разветвленные конструкции, которые обеспечивают дополнительную двухцепочечную платформу для взаимодействия с положительно заряженными N-концами, могут быть более предпочтительными мишенями.

Затем мы обнаружили, что способ взаимодействия, зарегистрированный для конструкции Y1_2_3 (), не был следствием ее конкретной первичной структуры, поскольку молекулы Y-формы строятся из олигонуклеотидов с природными последовательностями Y5, Y6 и Y7 или Y8, образующими тот же тип комплексы.Первая половина Y5 (32 нуклеотида) и последняя половина Y6 были взяты из перекрывающейся части фрагментов F1-R1 и F2-R2 (). Самостоятельная сборка этих конструкций из 96 п.о. (пример для Y5_Y6_Y7 на дорожке 4) была намного более эффективной, чем в случае триплекса Y1_2_3 (дорожка 1). Поэтому в смеси осталось очень небольшое количество дуплексов. Тем не менее, при 2-кратном молярном избытке белка, когда количество триплексов значительно снижается, несвязанные дуплексы все еще обнаруживаются (дорожка 6).Таким образом, вероятно, что среди разветвленных молекул с одно- и двухцепочечными разветвлениями Dps в основном выбирает последние.

Две модификации были использованы для повышения качества АСМ-изображений, полученных для комплексов Dps с разветвленной ДНК. Сначала мы добавили 26 нуклеотидов к 5’-концу Y5 и 3’-концу Y6 (9 нм), чтобы увеличить длину триплекса (и). Сайт, защищенный Dps против ДНКазы I, который расположен на 175 п.н. ниже праймера dps _F1 (), был включен в конструкцию.В результате мы наблюдали комплексы с четко видимыми одной или двумя ветвями ДНК (, два правых столбца). В первом случае Dps может быть прикреплен к точке ветвления или к концу одного из коротких плеч, тогда как во втором случае взаимодействие с точкой ветвления кажется более вероятным, но третье плечо было плохо видно. Затем мы заменили динуклеотид TT во внутренней части Y_7 на AA (олигонуклеотид Y8). В результате новый триплекс Y5_Y6_Y8 имел короткую однонитевую петлю в одной ветви. Эта модификация немного сместила связанный белок из центра (), показывая концы всех трех ветвей (см. 3D-изображение в).Следовательно, Dps связывает 3-стороннее соединение и, вероятно, обладает определенной специфичностью по отношению к одноцепочечным или гибким участкам ДНК. Если это так, связывание Dps с одноцепочечными разрывами в природной ДНК может вызвать плавление, подобное тому, которое наблюдается в. Чтобы проверить эту возможность, мы проанализировали комплексы, образованные Dps, с нативной и разорванной плазмидой pET28b.

Одноцепочечные разрывы в природной ДНК не были разупорядочены Dps

Очищенная плазмида pET28b выглядела как нативная и сильно свернутая молекула ().Он расщеплялся сайт-специфической никазой Nt.BspD6I, которая распознавала девять последовательностей GAGTC и делала одноцепочечные разрывы в верхней цепи на четыре основания по направлению к 3’-концу [50]. В результате плазмида стала расслабленной и даже фрагментированной (), поскольку несколько сайтов связывания близко расположены в этой ДНК. Комплексы с Dps образовывались при 5- и 10-кратном молярном избытке додекамеров Dps. Более высокое соотношение обеспечивало присутствие комплексов, образованных с разрезанной и неразрезанной ДНК, и позволяло обнаружить их различие, если таковое имеется, в то время как более низкое соотношение давало возможность увеличить долю комплексов, образованных с предпочтительными сайтами.Плотность связанных молекул Dps при 10-кратном избытке белка была выше на разорванной плазмиде по сравнению с нативной: 1 молекула на 117 ± 12 нм против 135 ± 23 нм соответственно (расчетная длина плазмиды 1917 нм). . Хотя разница не была статистически значимой, она соответствовала ожидаемому вкладу зарубок. Однако бинарные комплексы с додекамерами Dps в обоих случаях были очень похожи, и тщательное исследование не выявило одноцепочечных хвостов вблизи связанного белка ().

Примеры нативных (A, C) и никелированных (B, D, E) плазмид pET28b в свободном состоянии (A, B) и образующих комплексы с Dps (C-E) .

Белые полосы изображения в масштабе (нм). Горизонтальные и вертикальные стрелки на панелях C-E указывают комплексы с более низким и более высоким уровнями олигомеризации соответственно.

Как в нативных, так и в разорванных образцах мы обнаружили примерно 15% комплексов, образованных с частицами Dps, меньшими, чем додекамеры (обозначены горизонтальными стрелками). Следовательно, додекамерная форма не является абсолютно необходимой для взаимодействия с ДНК.Фрагментированные ДНК в большинстве случаев содержат молекулы Dps по крайней мере на одном конце двойной спирали. Таким образом, концевое специфическое взаимодействие с Dps не является специфическим свойством коротких линейных фрагментов ДНК. Образцы с разорванной плазмидой содержали в два раза больше комплексов, образованных с кажущимися агрегированными или каким-то образом перестроенными частицами Dps (30 и 15% соответственно), которые обычно были встроены в матрицу ДНК (вертикальные стрелки). Хотя их детальная структура требует специального изучения, уже ясно, что этот способ связывания может вызывать значительные конформационные переходы в ДНК, поскольку сверхспиральный стержень, отчетливо видимый рядом с комплексом 3 (), скорее всего, не может образоваться в исходной плазмиде, пройдя через обработка никазой и пробоподготовка.

Обсуждение

Dps - основной белок бактериального нуклеоида, конденсирующий геном и защищающий его от различных повреждений во время устойчивого роста и при различных стрессах. Это означает, что взаимодействие с ДНК является фундаментальной биологической функцией этой молекулы. Решающая роль в связывании принадлежит остаткам лизина, расположенным в положениях 5, 8, 10 и 18 двенадцати N-концевых модулей [15]. Их положительный заряд обеспечивает способность связывать отрицательно заряженную ДНК так же, как гистоны в геномах эукариот.Однако, в отличие от октамера гистонов, сферическая поверхность Dps заряжена отрицательно (). Таким образом, остается загадкой, почему эволюция выбрала этот белок для защитного взаимодействия с ДНК.

Кристаллическая структура Dps (PDB ID: 1DPS) была получена с разрешением 1,6 Å Грантом и др. [16].

Распределение заряда на поверхности Dps было рассчитано с использованием Swiss-PdbViewer версии 4.1.0 [52]. В панели [A] порог кулоновского окрашивания поверхности был установлен на -12 для красного (отрицательный электростатический потенциал), на -1.5 для белого и 0 для синего (положительный потенциал). В панели [C] масштаб был изменен на: -12, -4,8 и 0 соответственно. N-конец цепи «А» был пропорционально удлинен, чтобы схематично показать расположение Lys 5 и Lys 8 (синие шарики). N-концы двух других цепей были удлинены до положения 9 (как в цепи «А»). Серые звездочки в коде [C] обозначают концы гибких модулей. Панель [B] показывает центральную пору и расположение субъединиц около одной и той же вершины.Панель [D] схематически иллюстрирует различные способы взаимодействия, включая связывание с разветвленной ДНК со структурой «соскользнувшая петля» (слева), разорванной ДНК (две правые частицы) и прямой ДНК (вторая справа). В последнем случае два N-конца участвуют в связывании ДНК, а третий из той же вершины может связывать вакантный участок отрицательно заряженного пятна на поверхности другой молекулы Dps. Даже если такие контакты белок-белок могут образовываться в растворе, присутствие ДНК должно стабилизировать их и способствовать агрегации белка.Все размеры молекул на схеме указаны пропорционально натуральным размерам.

Комплексы с Dps были зарегистрированы для всех типов ДНК, испытанных в этом исследовании, и наблюдались два новых способа связывания (концевое связывание и взаимодействие с разветвленными молекулами ДНК). Поскольку линейные фрагменты ДНК () или усеченные ДНК () обычно имеют молекулы Dps на конце двойной спирали, мы предполагаем, что специфическое взаимодействие по концам более эффективно, чем связывание Dps с внутренними частями молекул ДНК.Однако искусственные триплексы обгоняли дуплексы в комплексообразовании с Dps (, дорожки 1–3), по-видимому, прикрепляя его к внутренней части конструкции (). Мы объяснили это предпочтение наличием сайта связывания для дополнительного N-конца в обеих новых мишенях. Поскольку в структуре додекамеров ДНК-связывающие модули мономеров сгруппированы в триады (), трехстороннее соединение может быть особенно выгодным для образования комплекса, так же как изогнутые и развернутые ДНК, включая частично расплавленные концы двойной спирали ДНК и одноцепочечные разрывы, тогда как взаимодействие с прямой ДНК может быть ограничено всего двумя контактами с N-концом.Если одноцепочечные разрывы являются мишенями для Dps, то уже известная способность этого белка уменьшать их количество в ответ на окислительный стресс [51] может быть опосредована не только физической защитой ДНК, но и его активным участием в связывании с такие дефекты.

Хотя первые 21 аминокислотный остаток в каждой субъединице Dps неструктурированы, 13 из них можно проследить в рентгеновской структуре [16], используя в качестве прототипа полипептидную цепь «А» (указана в) [16]. Таким образом, ясно, что неструктурированные N-концы довольно длинные и могут участвовать в электростатических взаимодействиях как с отрицательно заряженной ДНК, так и с отрицательно заряженной поверхностью белка.Т.е. они могут прилипать к белку за счет электростатических сил, как это наблюдалось для Dps A . tumefaciens [25] и могут не обнаруживаться в кристаллических структурах либо потому, что они гибкие, как принято считать, либо потому, что их контактные участки случайным образом распределены по всей доступной поверхности. Вот почему способность Dps агрегировать и образовывать олигомерные структуры является его внутренним свойством. Но эта способность в значительной степени стимулируется присутствием ДНК, а бинарные комплексы Dps-ДНК почти никогда не наблюдались в анализах гель-сдвига [1, 14, 19, 34, 39, 49].Хорошо известно, что основными участниками этого процесса являются те же N-концевые лизины, которые связывают ДНК [15]. Таким образом, было высказано предположение, что случайное связывание молекул Dps с ДНК ограничивает их подвижность в пространстве, тем самым увеличивая концентрацию белка в геноме и способствуя межбелковым взаимодействиям [15, 18, 28]. Эта модель очень хорошо объясняет образование крупных агрегатов, часто наблюдаемых с помощью АСМ, но не может объяснить образование высокоупорядоченных двумерных решетчатых массивов [14, 29] и низкую способность свободных Dps агрегировать даже в очень высокой концентрации (см. , например).Наши данные, подчеркивающие важность 3-кратной симметрии, позволили нам предложить другое объяснение сильной зависимости процесса агрегации от присутствия ДНК. Мы предполагаем, что в отсутствие ДНК N-концы Dps не являются полностью свободными. Вместо этого они случайным образом иммобилизуются на отрицательно заряженной поверхности белка. Три сильно заряженных пятна были обнаружены анализом поверхности с помощью Swiss-PdbViewer [52] (). Они расположены на удобном расстоянии от каждого N-конца, обеспечивая идеальную платформу для связывания, что снижает вероятность случайных внешних электростатических контактов.В присутствии ДНК один, два или три ДНК-связывающих модуля каждой вершины могут покинуть свои сайты связывания, освобождая их для контакта с N-концами других молекул Dps, если они расположены на доступном расстоянии. Примером этой ситуации служат две левые частицы. То есть, с нашей точки зрения, присутствие ДНК стимулирует белок-белковые связи за счет перераспределения электростатических контактов. Те из них, которые стабилизировали целостность додекамера без ДНК, вызывают агрегацию в новых условиях.

Способность Dps распознавать разветвленную двухцепочечную ДНК может иметь даже большее биологическое значение. В настоящее время известна только одна система в E . coli , который распознает и обрабатывает такие разветвленные структуры, как соединения Холлидея. Эти четырехсторонние соединения образуются во время рекомбинации и репарации ДНК и разрешаются системой, состоящей из трех белков - RuvA, RuvB и RuvC, где октамерная геликаза RuvA специально «скульптурирована» для взаимодействия с крестообразной ДНК [53].Трехсторонние соединения могут быть образованы в любом сегменте ДНК, содержащем по крайней мере два прямых повтора, где могут быть сформированы два типа структур со скользящей петлей (SLS, приведенный в качестве примера) [54]. В бактериальных геномах есть тысячи таких мест, включая кластеры регулярно расположенных коротких палиндромных повторов (CRISPR), принадлежащих бактериальной «иммунной» системе и тандемам сайтов связывания факторов транскрипции. Например, в промоторной области гена dps имеется четыре пары коротких прямых повторов, две из которых перекрываются с первичным сайтом контакта для Dps ().Структурное состояние участков генома с тандемными повторами должно находиться под особым контролем клеточных регуляторных систем. Но система, эволюционно адаптированная для этой функции, еще не известна, и бактериальный Dps может быть предложен в качестве кандидата на эту функцию. Его сродство к 3-стороннему соединению и способность вызывать конформационные изменения в ДНК (рис. И) являются весомыми аргументами в пользу такой возможности. Однако способность Dps к агрегации, которая в основном важна для конденсации генома в стрессовых условиях, может мешать тонкому функционированию, необходимому для управления структурным ландшафтом в активном геноме.

Есть один аспект, который также заслуживает некоторого внимания: если ДНК связана тремя N-концами одной вершины, что, как предполагается, является самым сильным способом взаимодействия, центральная пора белковой глобулы, ведущая в ее внутреннюю полость ( ), вплотную приближается к генетическому материалу. Даже небольшая утечка токсичных ионов железа из этой поры может разрушить целостность генома. Таким образом, вероятно, что, защищая ДНК от различных повреждающих агентов и удаляя токсичные ионы железа из геномной среды, Dps также может участвовать в структурно-специфическом разрушении нуклеиновых кислот.

В любом случае наши данные показали, что очищенный Dps E . coli собирается в стабильные додекамерные частицы с некоторым вкладом более мелких олигомеров. Взаимодействуя с ДНК, додекамерная форма Dps продемонстрировала определенную концевую специфичность и высокое сродство к трехстороннему соединению в искусственных молекулах ДНК. Поскольку связывание Dps с ДНК в основном осуществляется за счет электростатических взаимодействий, нет оснований исключать, что Dps также может образовывать комплексы с РНК, влияя на их функциональные свойства или стабильность, тем более что уже сообщалось, что «структуры кораллового рифа», образованные Dps2 М . smegmatis может разрушаться РНКазой А [55]. Таким образом, репертуар многофункционального белка Dps может быть даже шире, чем предполагалось в настоящее время.

Благодарности

Мы хотели бы выразить нашу благодарность Геннадию Енину из Института исследования белков Российской академии наук (РАН) за то, что он поделился с нами своим опытом в АСМ в ходе исследования, и Надежде Зыриной из института. теоретической и экспериментальной биофизики РАН за любезное предоставление Nt.Никаза BspD6I.

Отчет о финансировании

Работа поддержана Российским научным фондом (ОНО, грант 14-04-00985, http://rscf.ru/node/8), Министерством образования и науки Российской Федерации ( SSA, проект № 2504, http: //xn--80abucjiibhv9a.xn--p1ai) и Российский фонд фундаментальных исследований (ONO, 13-04-00997, http://www.rfbr.ru/rffi/eng). Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Доступность данных

Все данные содержатся в документе.

Ссылки

1. Азам Т.А., Исихама А. Двенадцать видов нуклеоид-ассоциированного белка из Escherichia coli . Специфичность распознавания последовательностей и аффинность связывания ДНК. J Biol Chem. 1999; 274: 33105–33113. 10.1074 / jbc.274.46.33105 [PubMed] [CrossRef] [Google Scholar] 2. Дорман CJ. Связанные с нуклеоидами белки и физиология бактерий. Adv Appl Microb. 2009. 67: 47–64. 10.1016 / S0065-2164 (08) 01002-2 [PubMed] [CrossRef] [Google Scholar] 3.Азам Т.А., Ивата А., Нишимура А., Уэда С., Исихама А. Зависящие от фазы роста изменения в белковом составе нуклеоида Escherichia coli . J Bacteriol. 1999; 181: 6361–6370. [Бесплатная статья PMC] [PubMed] [Google Scholar] 4. Гудман С.Д., Фельтен Нью-Джерси, Гао К., Робинсон С., Сегал А.М. In vitro выбор сайтов связывания факторов хозяина интеграции. J Bacteriol. 1999; 181: 3246–3255. [Бесплатная статья PMC] [PubMed] [Google Scholar] 5. Чо Б.К., Найт Э.М., Барретт К.Л., Палссон Б.О. Полногеномный анализ связывания Fis в Escherichia coli указывает на причинную роль A- / AT-трактов.Gen Res. 2008. 18: 900–910. 10.1101 / гр.070276.107 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 6. Чо Б.К., Барретт К.Л., Найт Е.М., Парк Ю.С., Палссон Б.О. Реконструкция в масштабе генома регуляторной сети Lrp в Escherichia coli . Proc Natl Acad Sci USA. 2008; 105: 19462–19467. 10.1073 / pnas.0807227105 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 7. Bouffartiques E, Buckle M, Badaut C, Travers A, Rimsky S. Кооперативное связывание H-NS с высокоаффинными сайтами в регуляторном элементе приводит к подавлению транскрипции.Nat Struct Mol Biol. 2007. 14: 441–448. 10.1038 / nsmb1233 [PubMed] [CrossRef] [Google Scholar] 8. Ueguchi C, Kakeda M, Yamada H, Mizumo T Аналог молекулярного шаперона DnaJ в Escherichia coli . Proc Nati Acad Sci USA. 1994; 91: 1054–1058. 10.1073 / pnas.91.3.1054 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 9. Блох V, Ян Y, Маржит E, Chavanieu A, Auge MT, Роберт Б. и другие. Домен димеризации H-NS определяет новую складку, способствующую распознаванию ДНК. Nat Struct Mol Biol.2003; 10: 212–218. 10.1038 / nsb904 [PubMed] [CrossRef] [Google Scholar] 10. Зонненфилд Дж. М., Бернс К. М., Хиггинс К. Ф., Хинтон Дж. К. Д. Связанный с нуклеоидом белок StpA связывает изогнутую ДНК, имеет большую аффинность связывания ДНК, чем H-NS, и присутствует в значительных количествах у мутантов hns . Биохимия. 2001; 83: 243–249. [PubMed] [Google Scholar] 11. Боннефой Э, Такахаши М, Янив Ю.Р. Параметры связывания ДНК белка HU Escherichia coli с крестообразной ДНК. J Mol Biol. 1994; 242: 116–129.10.1006 / jmbi.1994.1563 [PubMed] [CrossRef] [Google Scholar] 12. Castaing B, Zelwer C, Laval J, Boiteux S. Белок HU Escherichia coli специфически связывается с ДНК, которая содержит одноцепочечные разрывы или разрывы. J Biol Chem. 1995; 270: 10291–10296. 10.1074 / jbc.270.17.10291 [PubMed] [CrossRef] [Google Scholar] 13. Lavoie BD, Shaw GS, Millner A, Chaconas G. Анатомия комплекса флексер-ДНК внутри промежуточного соединения транспозиции более высокого порядка. Клетка. 1996; 85: 761–771. 10.1016 / S0092-8674 (00) 81241-6 [PubMed] [CrossRef] [Google Scholar] 14.Альмирон М.А., Линк Дж., Ферлонг Д., Колтер Р. Новый ДНК-связывающий белок с регуляторными и защитными функциями в голодных Escherichia coli . Genes Dev. 1992; 6: 2646–2654. 10.1016 / 0168-9525 (93)

-5 [PubMed] [CrossRef] [Google Scholar] 15. Ceci P, Cellai S, Falvo E, Rivetti C, Rossi GL, Chiancone E. Конденсация ДНК и самоагрегация Escherichia coli Dps - это связанные явления, связанные со свойствами N-конца. Nucl Acids Res. 2004. 32: 5935–5944. 10.1093 / нар / гх915 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 16.Грант Р.А., Фильм Диджей, Финкель С.Е., Колтер Р., Хогл Дж. М.. Кристаллическая структура Dps, гомолога ферритина, который связывает и защищает ДНК. Nat Struct Biol. 1998. 5: 294–303. 10.1038 / nsb0498-294 [PubMed] [CrossRef] [Google Scholar] 17. Де лос Риос С., Перона Дж. Дж. Структура Escherichia coli Лейцин-чувствительный регуляторный белок Lrp обнаруживает новую октамерную сборку. J Mol Biol. 2007; 366: 1589–1602. 10.1016 / j.jmb.2006.12.032 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 18. Сеси П., Илари А., Фалво Е., Джангиакомо Л., Чианконе Е.Повторная оценка стабильности белка, связывания ДНК и защиты Mycobacterium smegmatis Dps. J Biol Chem. 2005; 280: 34776–34785. 10.1074 / jbc.M502343200 [PubMed] [CrossRef] [Google Scholar] 20. Юань Х.С., Финкель С.Е., Фенг Я.А., Качор-Гжесковяк М., Джонсон Р.С., Дикерсон Р.Э. Молекулярная структура белка FIS дикого типа и мутантного белка FIS: взаимосвязь между мутационными изменениями и функцией рекомбинационного энхансера или связыванием ДНК. Proc Natl Acad Sci USA. 1991; 88: 9558–9562. 10.1073 / pnas.88.21.9558 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 21. Кавамура Т., Вартанян А.С., Чжоу Х., Далквист Ф.В. Дизайн участвует в регуляции PapI и Lrp оперона pap. J Mol Biol. 2011; 409: 311–332. 10.1016 / j.jmb.2011.01.05 [PubMed] [CrossRef] [Google Scholar] 22. Cordeiro TN, Schmidt H, Madrid C, Juarez A, Bernado P, Griesinger C. et al. Непрямое считывание ДНК белком, родственным H-NS: структура комплекса ДНК С-концевого домена Ler. Путь PLoS. 2011; 7: e1002380 10.1371 / journal.ppat.1002380 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 23. Райс ПА, Ян С.В., Мидзуучи К., Нэш Х.А. Кристаллическая структура комплекса ИГФ-ДНК: разворот ДНК, индуцированный белком. Клетка. 1996. 87: 1295–1306. 10.1016 / S0092-8674 (00) 81824-3 [PubMed] [CrossRef] [Google Scholar] 24. Стелла S, Cascio D, Johnson RC. Форма малой бороздки ДНК управляет связыванием ДНК-изгибающего белка Fis. Gen Dev. 2010; 24: 814–826. 10.1101 / gad.10 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 25.Сеси П., Илари А., Фалво Е., Чианконе Е. Белок Dps Agrobacterium tumefaciens не связывается с ДНК, но защищает ее от окислительного расщепления: кристаллическая структура рентгеновского излучения, связывание железа и свойства улавливания гидроксильных радикалов. J Biol Chem. 2003; 278: 20319–20326. 10.1074 / jbc.M302114200 [PubMed] [CrossRef] [Google Scholar] 26. Стиллман Т.Дж., Упадхьяй М., Норте В.А., Седельникова С.Е., Каррадус М., Цоков С. и др. Кристаллические структуры белков Dps Lactococcus lactis MG1363 показывают присутствие N-концевой спирали, которая необходима для связывания ДНК.Mol Microbiol. 2005; 57: 1101–1112. 10.1111 / j.1365-2958.2005.04757.x [PubMed] [CrossRef] [Google Scholar] 27. Чианконе Э., Сеси П. Многогранная способность белков Dps бороться с бактериальными стрессовыми состояниями: детоксикация железа и перекиси водорода и связывание ДНК. Biochim Biophys Acta. 2010; 1800: 798–805. 10.1016 / j.bbagen.2010.01.013 [PubMed] [CrossRef] [Google Scholar] 28. Ceci P, Mangiarotti L, Rivetti C, Chiancone E. Нейтрофил-активирующий белок Dps Helicobacter pylori , HP-NAP, использует механизм, отличный от Escherichia coli Dps для связывания и конденсации ДНК.Nucl Acids Res. 2007. 35: 2247–2256. 10.1093 / нар / гкм077 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 29. Гупта С., Чаттерджи Д. Бимодальная защита ДНК с помощью ДНК-связывающего белка Mycobacterium smegmatis из клеток стационарной фазы. J Biol Chem. 2003. 278: 5235–5241. 10.1074 / jbc.M208825200 [PubMed] [CrossRef] [Google Scholar] 30. Вольф С.Г., Френкиль Д., Арад Т., Финкель С.Е., Колтер Р., Мински А. Защита ДНК путем биокристаллизации, вызванной стрессом. Природа. 1999; 400: 83–85. 10.1038 / 21918 [PubMed] [CrossRef] [Google Scholar] 31.Frenkiel-Krispin D, Levin-Zaidman S, Shimoni E, Wolf SG, Wachtel EJ, Arad T. et al. Регулируемые фазовые переходы бактериального хроматина: неферментативный путь для общей защиты ДНК. EMBO J. 2001; 20: 1184–1191. 10.1093 / emboj / 20.5.1184 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 32. Френкиль-Криспин Д., Бен-Аврахам И., Энгландер Дж., Шимони Э., Вольф С. Г., Мински А. Реструктуризация нуклеоидов у бактерий в стационарном состоянии. Mol Microbiol. 2004. 51: 395–405. 10.1046 / j.1365-2958.2003.03855.x [PubMed] [CrossRef] [Google Scholar] 33.Азам Т.А., Хирага С., Исихама А. Два типа локализации ДНК-связывающих белков в нуклеоиде Escherichia coli . Гены Клетки. 2000. 5: 613–626. 10.1046 / j.1365-2443.2000.00350.x [PubMed] [CrossRef] [Google Scholar] 34. Френкиль-Криспин Д., Мински А. Нуклеоидная организация и поддержание целостности ДНК в E . coli , B . subtilis и D . радиодуранс . J. Struct Biol. 2006; 156: 311–319. 10.1016 / j.jsb.2006.05.014 [PubMed] [CrossRef] [Google Scholar] 35. Уэрго Л.Ф., Рахман Х., Ибрагимович А., Дэй С.Дж., Королика В. Campylobacter jejuni Белок Dps связывает ДНК в присутствии железа или перекиси водорода. J Bacteriol. 2013; 195: 1970–1978. 10.1128 / JB.00059-13 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 36. Зет К. Биоминерализующие белки Dps: многофункциональные архитекторы природы. Биохим Дж. 2012; 445: 297–311. 10.1042 / BJ20120514 [PubMed] [CrossRef] [Google Scholar] 37. Salgado H, Peralta-Gil M, Gama-Castro S, Santos-Zavaleta A, Muñiz-Rascado L, García-Sotelo JS.и другие. RegulonDB v8.0: наборы данных omics, эволюционное сохранение, нормативные фразы, перекрестно проверенные золотые стандарты и многое другое. Nucl Acids Res. 2013; 41 (выпуск базы данных): D203–213. 10.1093 / нар / гкс1201 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 38. Calhoun LN, Kim JN, Ren Y, Song JJ, Kwon YM. ДНК-связывающий белок Dps функционирует как глобальный регулятор при голодании Salmonella enterica сероварном энтеридите во время голодания. Int J Microb Res. 2011; 3: 136–147. 10.9735 / 0975-5276.3.3.136-147. [CrossRef] [Google Scholar] 39. Пуртов Ю.А., Глазунова О.А., Антипов С.С., Покусаева В.О., Фесенко Е.Е., Преображенская Е.В. и другие. Промоторные острова как платформа для взаимодействия с нуклеоидными белками и факторами транскрипции. J Bioinform Comput Biol. 2014; 12: 1441006 10.1142 / S0219720014410066 [PubMed] [CrossRef] [Google Scholar] 40. Ilari A, Ceci P, Ferrari D, Rossi GL, Chiancone E. Включение железа в Escherichia coli Dps дает ферритиноподобное микрокристаллическое ядро.J Biol Chem. 2002; 277: 37619–37623. 10.1074 / jbc.M206186200 [PubMed] [CrossRef] [Google Scholar] 41. Ивахори К., Эномото Т., Фурушо Х., Миура А., Нишио К., Мисима Ю. и др. Синтез наночастиц сульфида кадмия в белке Dps из Listeria innocua . Chem Mater. 2007. 19: 3105–3111. 10,1021 / см 0628799 [CrossRef] [Google Scholar] 42. Игараси К., Исихама А. Двудольная функциональная карта E . coli альфа-субъединица РНК-полимеразы: участие С-концевой области в активации транскрипции с помощью цАМФ-CRP.Клетка. 1991; 65: 1015–1022. 10.1016 / 0092-8674 (91) -Б [PubMed] [CrossRef] [Google Scholar] 43. Тутукина М.Н., Шавкунов К.С., Масулис И.С., Озолин О.Н. Антисмысловая транскрипция в локусе hns Escherichia coli . Мол Биол (Моск). 2010. 44: 439–447. 10.1134 / S002689331003012X [PubMed] [CrossRef] [Google Scholar] 44. Маниатис Т., Фриш Э. Ф., Сэмбрук Дж. Молекулярное клонирование: лабораторное руководство. Колд-Спринг-Харбор, Нью-Йорк: Лаборатория Колд-Спринг-Харбор. Нажмите; 1982. [Google Scholar] 45.Рогулин Е.А., Перевязова Т.А., Железная Л.А., Матвиенко Н.И. Плазмида pRARE как вектор для клонирования с целью конструирования суперпродуцента сайт-специфической никазы N.BspD6I. Биохимия (Москва). 2004. 69: 1123–1127. 10.1023 / B: BIRY.0000046886.19428.d5 [PubMed] [CrossRef] [Google Scholar] 47. Altuvia S, Almiron M, Huisman G, Kolter R, Storz G. Промотор dps активируется OxyR во время роста и IHF и σ S в стационарной фазе. Mol Microbiol. 1994; 13: 265–272. 10.1111 / j.1365-2958.1994.tb00421.Икс [PubMed] [CrossRef] [Google Scholar] 48. Lacour S, Landini P. Экспрессия SigmaS-зависимых генов в начале стационарной фазы в Escherichia coli : функция sigmaS-зависимых генов и идентификация их промоторных последовательностей. J Bacteriol. 2004; 186: 7186–7195. 10.1128 / JB.186.21.7186-7195.2004 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 49. Швырева У.С., Тутукина М.Н., Озолин О.Н. Бактериоферритин: свойства, структурная и функциональная организация регуляторной области гена dps .Биофизика. 2011; 56: 795–802. 10.1134 / S00063500204 [PubMed] [CrossRef] [Google Scholar] 50. Мачулин А.В., Дерюшева В.И., Юнусова А.К., Железная Л.А., Сердюк И.Н. Исследование сайт-специфического связывания ДНК с никелирующей эндонуклеазой Nt.BspD6I на уровне отдельной молекулы с помощью атомно-силовой микроскопии. Биофизика. 2012; 57: 314–317. 10.1134 / S00063500128 [PubMed] [CrossRef] [Google Scholar] 52. Guex N, Peitsch MC. SWISS-MODEL и Swiss-PdbViewer: среда для сравнительного моделирования белков.Электрофорез. 1997; 18: 2714–2723. 10.1002 / elps.1150181505 [PubMed] [CrossRef] [Google Scholar] 55. Гхатак П., Кармакар К., Касетти С., Чаттерджи Д. Раскрытие роли Dps в организации микобактериальных нуклеоидов. PLoS ONE. 2011; 6: e16019 10.1371 / journal.pone.0016019 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

Произошла ошибка при настройке вашего пользовательского файла cookie

Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


Настройка вашего браузера для приема файлов cookie

Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

  • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файлы cookie.
  • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
  • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

Как правило, в файлах cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

Евразийский журнал биологических наук - 2020, Vol. 14, Выпуск 1

Аннотация

Овцеводство в Казахстане - одно из традиционных направлений животноводства.В последние годы тенденция развития овцеводства, независимо от направления продуктивности и специализации отрасли, во всех зонах сосредоточена на производстве баранины и баранины - основного источника дохода. Научно-исследовательские работы проводились в период 1992-2013 гг. В опытном базовом хозяйстве «Сералы» Ордабасынского района и реализовывались в хозяйствах «Ортай», «Рау», «Сабыр», «Медеу-ата», «Акбастау», « Канат »,« Сайрам-Астык »и общества с ограниченной ответственностью« Бек »,« Парпата »Южно-Казахстанской области.Объект исследования - казахские жирнохвостые грубошерстные овцы и баран-производители Эдильбайской (отечественной) и Гиссарской (иностранной) пород овец, помеси различных поколений, полученные методом трехпородного скрещивания, и новая порода Ордабасы. а также баранину и баранину. Цель исследований - создать новую породу, сочетающую в себе высокую живую массу, скороспелость и адаптивность исходных пород, которая характеризуется экономической эффективностью при производстве высококачественной экологически чистой баранины, баранины и обеспечивает сельхозпроизводителей генетически ценными. перспективный племенной материал для устойчивого развития овцеводства в Казахстане.Результаты исследований. Разработана принципиально новая технология выведения новой породы овец ордабасы с использованием метода трехпородного репродуктивного скрещивания лучших генотипов отечественных и зарубежных пород мясо-жировых овец, созданных народной селекцией в Казахстане и Средней Азии. Суть технологии разведения новой породы овец Ордабасы заключается в управлении наследственностью и изменчивостью хозяйственных и полезных признаков в новых поколениях с оптимальными генетическими комбинациями.
Новая технология состоит из отдельных технологических процессов.Первый процесс (1992-1996 гг.) - скрещивание овцематок казахской жирнохвостой грубошерстной породы с баранами Эдильбайской породы, то есть в течение пяти лет исходной родительской породы, искусственно осемененной баранами Эдильбайской породы, с получением помесей первого поколения. На данном этапе эксперимента было использовано 5718 овцематок казахской жирнохвостой грубошерстной породы и 17 баранов эдильбайской породы. Второй технологический процесс (1994-2000 гг.) - скрещивание животных первого поколения «Казахская курчавая курчавка х Эдильбай» по достижении полового созревания и взрослых овцематок этого генотипа с баранами гиссарской породы на 7 лет в порядке. выбрать желаемые виды для разведения.На данном этапе эксперимента помеси первого поколения в количестве 3178 животных были скрещены с гиссарскими овцами и отобраны модельные животные нужного типа. Третий технологический процесс (1996-2003 гг.) - выведение помесей желаемого типа «в себе». На данном этапе научных работ были разработаны методы стабилизации популяции в заданном направлении и крупномасштабно выращены высокопродуктивные линейные животные с целью закрепления экономически полезных характеристик выбранного типа животных.
Четвертый технологический процесс (2005-2013 гг.) - создание и испытание новой породы овец ордабасы. Внедрение племенных животных и внедрение новой породы в сельскохозяйственное производство. Новая высокопродуктивная порода ордабасы характеризуется крупным крепким телосложением, глубокой и широкой грудью, выступающей вперед, округло-бочкообразным телом, поднятым хвостом, хорошо развитым позвоночником, шеями средней длины, крепкими ногами средней длины, опушением, высокими репродуктивными качествами и продуктивностью. высококачественные экологически чистые баранины и баранины в круглогодичном пастбищном содержании.Производство ягненка из баранов новой породы Ордабасы оказалось более рентабельным в производстве конкурентоспособной «молочной» баранины на внутреннем и внешнем рынках, чем производство ягнят других пород, что свидетельствует об эффективности разведения этой уникальной породы для интенсификации производства. из качественной баранины. Новая ордабасынская порода овец широко внедрена в сельскохозяйственное производство, ее численность составляет более 75 тысяч голов, в том числе чистопородных - более 36 тысяч голов.Племенные животные новой породы проданы 125 субъектам различных форм собственности в количестве 12388 голов и успешно разводятся в различных регионах Казахстана. Рекомендуемые зоны разведения ордабасынской породы овец - полупустыня, пустыня, степь, сухостепь, предгорье и гора.

Ключевые слова: овцеводство, баранина, баранина, скрещивание, ордабасы

Образец цитирования: Ажиметов Н.Н., Паржанов З.А., Алибаев Н.Н., Мырзакулов А.С.Новая ордабасынская порода овец - прорывная технология производства баранины и баранины: теория и практика. Евразия J Biosci. 2020; 14 (1): 1193-201.

% PDF-1.7 % 2818 0 объект > эндобдж xref 2818 367 0000000016 00000 н. 0000016366 00000 п. 0000016601 00000 п. 0000016640 00000 п. 0000016678 00000 п. 0000017595 00000 п. 0000018596 00000 п. 0000018736 00000 п. 0000018872 00000 п. 0000019008 00000 н. 0000019144 00000 п. 0000019280 00000 п. 0000019416 00000 п. 0000019552 00000 п. 0000019688 00000 п. 0000019824 00000 п. 0000019960 00000 п. 0000020096 00000 н. 0000020232 00000 п. 0000020368 00000 п. 0000020504 00000 п. 0000020640 00000 п. 0000020776 00000 п. 0000020912 00000 п. 0000021048 00000 п. 0000021184 00000 п. 0000021320 00000 н. 0000021456 00000 п. 0000021592 00000 п. 0000021728 00000 п. 0000021864 00000 п. 0000022000 00000 н. 0000022136 00000 п. 0000022272 00000 п. 0000022408 00000 п. 0000022544 00000 п. 0000022680 00000 п. 0000022816 00000 п. 0000022952 00000 п. 0000023087 00000 п. 0000023221 00000 п. 0000023355 00000 п. 0000023492 00000 п. 0000023629 00000 п. 0000023766 00000 п. 0000023903 00000 п. 0000024040 00000 п. 0000024177 00000 п. 0000024314 00000 п. 0000024451 00000 п. 0000024588 00000 п. 0000024725 00000 п. 0000024862 00000 п. 0000024999 00000 н. 0000025136 00000 п. 0000025273 00000 п. 0000025410 00000 п. 0000025547 00000 п. 0000025684 00000 п. 0000025821 00000 п. 0000025957 00000 п. 0000026094 00000 п. 0000026231 00000 п. 0000026368 00000 п. 0000026505 00000 п. 0000026642 00000 п. 0000026779 00000 п. 0000026916 00000 п. 0000027052 00000 п. 0000027189 00000 п. 0000027326 00000 н. 0000027462 00000 н. 0000027597 00000 п. 0000027731 00000 н. 0000027866 00000 н. 0000028001 00000 п. 0000028136 00000 п. 0000028273 00000 п. 0000028410 00000 п. 0000028547 00000 п. 0000028684 00000 п. 0000028821 00000 п. 0000028958 00000 п. 0000029095 00000 п. 0000029232 00000 п. 0000029369 00000 п. 0000029506 00000 п. 0000029643 00000 п. 0000029780 00000 п. 0000029917 00000 н. 0000030053 00000 п. 0000030190 00000 п. 0000030327 00000 п. 0000030464 00000 п. 0000030600 00000 п. 0000030737 00000 п. 0000030873 00000 п. 0000031008 00000 п. 0000031145 00000 п. 0000031282 00000 п. 0000031419 00000 п. 0000031558 00000 п. 0000031695 00000 п. 0000031832 00000 п. 0000031969 00000 п. 0000032106 00000 п. 0000032243 00000 п. 0000032378 00000 п. 0000032515 00000 п. 0000032651 00000 п. 0000032789 00000 п. 0000032924 00000 п. 0000033059 00000 п. 0000033194 00000 п. 0000033329 00000 п. 0000033461 00000 п. 0000033596 00000 п. 0000034160 00000 п. 0000034493 00000 п. 0000034987 00000 п. 0000035509 00000 п. 0000036070 00000 п. 0000036382 00000 п. 0000037131 00000 п. 0000037625 00000 п. 0000037725 00000 п. 0000038245 00000 п. 0000038284 00000 п. 0000038313 00000 п. 0000038947 00000 п. 0000039060 00000 н. 0000039175 00000 п. 0000039301 00000 п. 0000039937 00000 н. 0000040025 00000 п. 0000040174 00000 п. 0000040451 00000 п. 0000040480 00000 п. 0000041024 00000 п. 0000041415 00000 п. 0000041865 00000 п. 0000044517 00000 п. 0000046961 00000 п. 0000047408 00000 п. 0000051049 00000 п. 0000054655 00000 п. 0000058548 00000 п. 0000058687 00000 п. 0000058851 00000 п. 0000062205 00000 п. 0000062600 00000 п. 0000066256 00000 п. 0000069204 00000 п. 0000071855 00000 п. 0000071926 00000 п. 0000072024 00000 п. 0000072290 00000 п. 0000072702 00000 п. 0000072828 00000 п. 0000076427 00000 н. 0000076551 00000 п. 0000076700 00000 п. 0000076796 00000 п. 0000076907 00000 п. 0000082555 00000 п. 0000109199 00000 п. 0000109317 00000 п. 0000147800 00000 н. 0000152201 00000 н. 0000152312 00000 н. 0000152344 00000 н. 0000152421 00000 н. 0000159922 00000 н. 0000160243 00000 н. 0000160312 00000 н. 0000160430 00000 н. 0000160462 00000 н. 0000160539 00000 н. 0000169009 00000 н. 0000169330 00000 н. 0000169399 00000 н. 0000169517 00000 н. 0000169549 00000 н. 0000169626 00000 н. 0000183090 00000 н. 0000183413 00000 н. 0000183482 00000 н. 0000183600 00000 н. 0000183632 00000 н. 0000183709 00000 н. 0000184030 00000 н. 0000184099 00000 н. 0000184217 00000 н. 0000184249 00000 н. 0000184326 00000 н. 0000198398 00000 н. 0000198723 00000 н. 0000198792 00000 н. 0000198910 00000 н. 0000198942 00000 н. 0000199019 00000 н. 0000204282 00000 н. 0000204604 00000 н. 0000204673 00000 н. 0000204791 00000 н. 0000204823 00000 н. 0000204900 00000 н. 0000209152 00000 н. 0000209472 00000 н. 0000209541 00000 н. 0000209659 00000 н. 0000209730 00000 н. 0000209826 00000 н. 0000218430 00000 н. 0000218714 00000 н. 0000218967 00000 н. 0000218996 00000 н. 0000219366 00000 н. 0000221220 00000 н. 0000221547 00000 н. 0000221934 00000 н. 0000237465 00000 н. 0000237729 00000 н. 0000238119 00000 н. 0000243166 00000 н. 0000243429 00000 н. 0000243805 00000 н. 0000250590 00000 н. 0000250859 00000 н. 0000260470 00000 н. 0000260753 00000 п. 0000261113 00000 н. 0000261259 00000 н. 0000261402 00000 н. 0000261479 00000 п. 0000261780 00000 н. 0000261857 00000 н. 0000261983 00000 н. 0000262284 00000 н. 0000262361 00000 н. 0000262663 00000 н. 0000262740 00000 н. 0000263041 00000 н. 0000263118 00000 н. 0000263417 00000 н. 0000263494 00000 н. 0000263795 00000 н. 0000263872 00000 н. 0000264170 00000 н. 0000265065 00000 н. 0000315361 00000 н. 0000317833 00000 н. 0000325512 00000 н. 0000326407 00000 н. 0000327302 00000 н. 0000344889 00000 н. 0000398459 00000 н. 0000398546 00000 н. 0000398633 00000 н. 0000398720 00000 н. 0000398807 00000 н. 0000398894 00000 н. 0000398981 00000 н. 0000399068 00000 н. 0000399155 00000 н. 0000399242 00000 н. 0000399329 00000 н. 0000399416 00000 н. 0000399503 00000 н. 0000399590 00000 н. 0000399677 00000 н. 0000399764 00000 н. 0000399851 00000 н. 0000399938 00000 н. 0000400025 00000 н. 0000400112 00000 н. 0000400199 00000 п. 0000400286 00000 н. 0000400373 00000 п. 0000400460 00000 н. 0000400547 00000 н. 0000400634 00000 п. 0000400721 ​​00000 н. 0000400808 00000 н. 0000400895 00000 н. 0000400982 00000 н. 0000401069 00000 н. 0000401156 00000 н. 0000401243 00000 н. 0000401330 00000 н. 0000401417 00000 н. 0000401504 00000 н. 0000401591 00000 н. 0000401678 00000 н. 0000401765 00000 н. 0000401852 00000 н. 0000401939 00000 н. 0000402026 00000 н. 0000402113 00000 п. 0000402200 00000 н. 0000402287 00000 н. 0000402374 00000 н. 0000402461 00000 н. 0000402548 00000 н. 0000402635 00000 н. 0000402722 00000 н. 0000402809 00000 н. 0000402896 00000 н. 0000402983 00000 н. 0000403070 00000 н. 0000403157 00000 н. 0000403244 00000 н. 0000403331 00000 н. 0000403418 00000 н. 0000403505 00000 н. 0000403592 00000 н. 0000403679 00000 н. 0000403766 00000 н. 0000403853 00000 п. 0000403940 00000 н. 0000404027 00000 н. 0000404114 00000 п. 0000404201 00000 н. 0000404288 00000 н. 0000404375 00000 н. 0000404462 00000 н. 0000404549 00000 н. 0000404636 00000 н. 0000404723 00000 н. 0000404810 00000 н. 0000404897 00000 н. 0000404984 00000 н. 0000405071 00000 н. 0000405158 00000 н. 0000405245 00000 н. 0000405332 00000 н. 0000405419 00000 п. 0000405506 00000 н. 0000405593 00000 п. 0000405680 00000 п. 0000405767 00000 н. 0000405854 00000 п. 0000405941 00000 н. 0000406028 00000 н. 0000406115 00000 н. 0000406202 00000 н. 0000406289 00000 н. 0000406376 00000 п. 0000406463 00000 н. 0000406550 00000 н. 0000406637 00000 н. 0000406724 00000 н. 0000406811 00000 н. 0000406898 00000 н. 0000406985 00000 н. 0000407072 00000 н. 0000407159 00000 н. 0000407246 00000 н. 0000407333 00000 н. 0000407420 00000 н. 0000407507 00000 н. 0000407594 00000 н. 0000407681 00000 н. 0000407768 00000 н. 0000407855 00000 н. 0000407942 00000 н. 0000007636 00000 н. трейлер ] / Назад 5372737 >> startxref 0 %% EOF 3184 0 объект > поток h {yX ׶` (BHbhk8,2 ն [! H "PE4"! S BPV: H {T = jSQZh Q_Ƣ'X 䈜 r: XƸPek (SICcy ^ 18xσ2 *> * W ج ~ ĎG ܐ E $ ƞGVl \% OS: OQg ߨ S> Wpkš ֒ Y` ډ) ϓvs}.52] Ew)>] Mn + / '| UGWeS [bw Qi2j) CJ) Jt9ͱ; KG3}; Aʣ \ Kd8 * mhu5 # jÂ%] $ cFa] eNsƜyt

EAA - 2019 - PB - Online - 2 сентября | PDF | Археология

Вы читаете бесплатный превью
Page 12 не отображается в этом предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 16 по 27 не показаны в этом предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 31 по 33 не показаны в этом предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 37 по 48 не показаны в этом предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 52 по 55 не показаны в этом предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 68 по 71 не показаны в этом предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 76 по 91 не показаны в этом предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 96 по 97 не показаны при предварительном просмотре.

Вы читаете бесплатный превью
Page 102 не отображается в этом предварительном просмотре.

Вы читаете бесплатный превью
Страницы со 107 по 124 не показаны в этом предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 136 по 141 не показаны при предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 145 по 147 не показаны в этом предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 151 по 158 не показаны при предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 162 по 165 не показаны в этом предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 169 по 179 не показаны в этом предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 191 по 193 не показаны при предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 197 по 204 не показаны при предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 225 по 245 не показаны в этом предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 258 по 271 не показаны в этом предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 284 по 340 не показаны при предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 353 по 395 не показаны в этом предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 408 по 410 не показаны в этом предварительном просмотре.

.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *